ID: 1096546398

View in Genome Browser
Species Human (GRCh38)
Location 12:52343050-52343072
Sequence TACTCCCAAGAGGTTAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096546390_1096546398 23 Left 1096546390 12:52343004-52343026 CCTCAAGCACGGACAATTGGACA No data
Right 1096546398 12:52343050-52343072 TACTCCCAAGAGGTTAGGGTTGG No data
1096546387_1096546398 30 Left 1096546387 12:52342997-52343019 CCTTGTCCCTCAAGCACGGACAA No data
Right 1096546398 12:52343050-52343072 TACTCCCAAGAGGTTAGGGTTGG No data
1096546389_1096546398 24 Left 1096546389 12:52343003-52343025 CCCTCAAGCACGGACAATTGGAC No data
Right 1096546398 12:52343050-52343072 TACTCCCAAGAGGTTAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096546398 Original CRISPR TACTCCCAAGAGGTTAGGGT TGG Intergenic
No off target data available for this crispr