ID: 1096547411

View in Genome Browser
Species Human (GRCh38)
Location 12:52350177-52350199
Sequence CAGCTCAGCCAGCTTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096547411_1096547419 11 Left 1096547411 12:52350177-52350199 CCCACTGCAAGCTGGCTGAGCTG 0: 1
1: 1
2: 4
3: 24
4: 211
Right 1096547419 12:52350211-52350233 GCAGAAGGCCAAGCAGGACATGG No data
1096547411_1096547415 -4 Left 1096547411 12:52350177-52350199 CCCACTGCAAGCTGGCTGAGCTG 0: 1
1: 1
2: 4
3: 24
4: 211
Right 1096547415 12:52350196-52350218 GCTGGAGGACGCCCTGCAGAAGG 0: 1
1: 7
2: 20
3: 54
4: 257
1096547411_1096547416 5 Left 1096547411 12:52350177-52350199 CCCACTGCAAGCTGGCTGAGCTG 0: 1
1: 1
2: 4
3: 24
4: 211
Right 1096547416 12:52350205-52350227 CGCCCTGCAGAAGGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096547411 Original CRISPR CAGCTCAGCCAGCTTGCAGT GGG (reversed) Intergenic
900115684 1:1026873-1026895 CAGCTCACCCAGCAGGCAGGAGG - Intronic
900666025 1:3816062-3816084 CTGCACAGCCAGTTTGCAGGTGG + Intronic
902926383 1:19698444-19698466 CACCTCAGCTAGCTTCCAGAAGG + Intronic
903573825 1:24325530-24325552 TAGCTCAGCCAGAAAGCAGTGGG + Intronic
905273883 1:36804857-36804879 CAGCTCACCCTGCATCCAGTCGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915832133 1:159140961-159140983 AAGCTCATCCAGCTTGCTGCTGG + Intronic
918096642 1:181341565-181341587 CAGCTCAACCAGCCTGCAAGGGG + Intergenic
918728233 1:187953653-187953675 CTGGTCATCCAGCTTGCAGACGG - Intergenic
920200882 1:204259140-204259162 CAACTCAGCCTGCTTCCAGAAGG + Intronic
920336644 1:205249501-205249523 CCGCTCAGCCAGCCGGCCGTGGG + Intronic
922909432 1:229203387-229203409 CAGCTCATGCATTTTGCAGTTGG - Intergenic
924917638 1:248590212-248590234 CAGCGCAACCAGCATGCACTGGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064267605 10:13837485-13837507 CAGATCAGAAAGCTGGCAGTGGG + Intronic
1066369337 10:34806857-34806879 CAGCTCAGGGAACTGGCAGTGGG + Intronic
1067078223 10:43199984-43200006 CAGCACAGCCATCTTGGAGCAGG + Intronic
1067078555 10:43201622-43201644 CAGCTCAGCTGGCCAGCAGTGGG - Intronic
1067112941 10:43413435-43413457 CAGCTCAGCCATCTAGAAGCTGG - Intergenic
1068977279 10:63023429-63023451 CAGGTCAGCAAGCCTGCAGCTGG - Intergenic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1069627084 10:69875010-69875032 CAGCTAACCCAGTTTGCAGCGGG - Intronic
1075376899 10:121985603-121985625 CAGCTCATCCAAATTGAAGTGGG - Intergenic
1076887969 10:133271239-133271261 CCCCTCAGCCAGCTGGCAGGTGG + Exonic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077739844 11:4833619-4833641 CAGCTCAACAGGCTTGCAGCAGG - Intronic
1078256162 11:9660865-9660887 CAGCTCAGGCTGCTTCCCGTTGG - Intergenic
1078317945 11:10307524-10307546 CAGCTCAGCCCGCTCAGAGTAGG - Intergenic
1078358668 11:10651902-10651924 CAGCTCATGTAGGTTGCAGTGGG - Intronic
1080559217 11:33446911-33446933 CAGCTCAGCCCTCTTTCAATAGG + Intergenic
1080685289 11:34510383-34510405 CTACTTAGCCAGCATGCAGTAGG + Intronic
1081741178 11:45441876-45441898 CAGCTCAACCCCCTTGCACTTGG + Intergenic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084118704 11:67056664-67056686 CAGCGCGGCCAGCTCACAGTAGG + Intergenic
1085121929 11:73973017-73973039 CAGCTCAGCCAGGCTGCAGGGGG - Intergenic
1085123153 11:73980313-73980335 CAGCTCACCCAGCTTCCTCTTGG + Intronic
1088485422 11:110335672-110335694 CTGCTCAGCCGGAGTGCAGTAGG - Intergenic
1088913779 11:114211756-114211778 CAGGAAGGCCAGCTTGCAGTGGG + Intronic
1090276628 11:125424605-125424627 CAGATCAGCGAGCTTCCATTAGG - Intronic
1090333442 11:125948013-125948035 CAGCACAGCCAGCGTGAGGTGGG - Intergenic
1090750257 11:129740686-129740708 CAGAGCAGCCTGCTTGGAGTGGG - Intergenic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1093905146 12:24681848-24681870 CATCTCAGGGAGCTGGCAGTGGG - Intergenic
1094012642 12:25825473-25825495 GAGCTCAGCCAGCTGACACTTGG - Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096536349 12:52277574-52277596 CAGCCAAGCCAGCTTGCCCTTGG - Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096552205 12:52380497-52380519 CAGATCTGCCAGCTTGCATTTGG + Exonic
1096554706 12:52396146-52396168 CAGCCCTGCCAGCTTGCACTTGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1096977287 12:55706891-55706913 CAGGTCTGCCAACCTGCAGTAGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1103222726 12:119259367-119259389 CAGCCCAGGCAGGCTGCAGTGGG + Intergenic
1103486620 12:121287457-121287479 CAGCCCAGCAGGCTCGCAGTTGG + Intronic
1104225410 12:126827916-126827938 CAGCTCATTCGGCTTGCTGTGGG - Intergenic
1106006916 13:25779371-25779393 CAGGGCAGCCAGCTGGGAGTGGG + Intronic
1106082723 13:26513961-26513983 AAGGTCAGCCAGATTGCAGTTGG + Intergenic
1107469883 13:40681955-40681977 CAGCCCAGCCAGTTCCCAGTGGG - Intergenic
1111300404 13:86342125-86342147 CAGCTCAGCCACATTGGAATAGG - Intergenic
1113156758 13:107332246-107332268 CAAATCACCCAGCTTGCAGAAGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1118866652 14:69709662-69709684 CAGCTCAGCCATTTACCAGTGGG - Intronic
1119761481 14:77155070-77155092 CAGGTCACCCAGCTTGTAGGTGG + Intronic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1120817082 14:88872403-88872425 CAGCACAGCCAGGTTGTTGTAGG - Exonic
1120870891 14:89336572-89336594 CAGGTCACACAGCTTGCAGATGG - Intronic
1122922970 14:104887530-104887552 TAGCTCAGCCAGCTCCCAGAAGG + Exonic
1123125195 14:105941214-105941236 CAGATCAGCCAGCCTGCAGTGGG - Intergenic
1125450948 15:39806714-39806736 CAGTTCAGCTTGGTTGCAGTTGG - Intronic
1125525474 15:40371399-40371421 CATCTCAGCCAGATTCCAGAGGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1130905305 15:88235842-88235864 CAGCTCTGCCACCTACCAGTTGG + Intronic
1132328295 15:100990494-100990516 CCCCTCAGCCAGCAAGCAGTAGG + Intronic
1132473579 16:120655-120677 CAACCCAGTCAGGTTGCAGTTGG + Intronic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1136508588 16:30722244-30722266 CAGGTGCGCCAGCTTGCTGTGGG + Exonic
1137497387 16:48981285-48981307 CACTTGAGCCAGCTTGCACTGGG - Intergenic
1139171535 16:64635891-64635913 CAGCTCTGGCATTTTGCAGTAGG + Intergenic
1140128777 16:72139242-72139264 CAGCTCAGCCCGATCCCAGTAGG + Intronic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141701875 16:85646373-85646395 CAGCTGTGCAAGCTTGCACTTGG - Intronic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1141922971 16:87148382-87148404 CAGCTTTGCCAGCATGGAGTTGG + Intronic
1142365232 16:89646584-89646606 CAGCTCAGCCAGCTGCCCGAGGG - Exonic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1143356255 17:6331041-6331063 CAGCTCAGCCAGGCAGCAGGAGG + Intergenic
1143723058 17:8827172-8827194 CATCTCAGCCAGCTTGTGGATGG + Exonic
1150143706 17:62750857-62750879 CAGCTCATTAAGCTGGCAGTGGG - Intronic
1151277117 17:73043518-73043540 CAGCTTAGCCAGCATGGAGCAGG + Intronic
1151352538 17:73540169-73540191 CACCTCTTCCAGCTTCCAGTGGG - Intronic
1151357731 17:73570418-73570440 CTGCTCACCCAGCCAGCAGTGGG - Intronic
1152199620 17:78937770-78937792 CAGGTCACCCAGCTGGCGGTAGG - Intergenic
1152206177 17:78975903-78975925 CAGCACAGCCAGCTCCCAGGAGG - Intronic
1152571707 17:81123973-81123995 GACCCCAGCCAGCGTGCAGTGGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157513461 18:48294946-48294968 TACTGCAGCCAGCTTGCAGTAGG - Intronic
1157813548 18:50715176-50715198 CATCTCAGCCAGGATGCAGCCGG - Exonic
1158419545 18:57280574-57280596 CAGCTCAGAAAACTAGCAGTTGG + Intergenic
1160428097 18:78792162-78792184 CAGCTCCTCCACCCTGCAGTTGG + Intergenic
1160702448 19:514541-514563 GTGCTAAGCCAGCATGCAGTAGG - Intronic
1160927050 19:1551698-1551720 CAGCTGAGCAACCCTGCAGTGGG + Intergenic
1160982010 19:1820511-1820533 CAGATCAGCCTGGCTGCAGTAGG + Intronic
1161347601 19:3776042-3776064 CTTCTCAGCCAACTTGCAGAAGG + Intergenic
1163277868 19:16296805-16296827 CAGCGAAGCCAGCAGGCAGTGGG - Intergenic
1163802224 19:19373241-19373263 CAGCCCAGCCAGCTGGTAGGAGG - Intergenic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1165898584 19:39157465-39157487 CGGCTCAGCCAGCCTGCACATGG - Intronic
1166253413 19:41586255-41586277 CAGCTCAGCCAGATGCCAGTGGG - Intronic
1167644569 19:50698766-50698788 CAGCTCAGTCTGCTTCCAGAGGG + Intronic
926146587 2:10400202-10400224 CGGCTCAGCCAGGTCGGAGTGGG + Intronic
928112541 2:28522307-28522329 GAGCTCTGCCTGCTTTCAGTGGG - Intronic
928321008 2:30282856-30282878 CAGCTCAGGCAGCTCCCAGGGGG + Intronic
932348045 2:71008451-71008473 CCACTCAGGCAGCCTGCAGTCGG + Intergenic
937411944 2:121684283-121684305 CAGCCCCGCCAGCTGGCCGTAGG - Intergenic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
941043442 2:160648342-160648364 CACCTCCCCCAGCATGCAGTGGG - Intergenic
941910965 2:170764125-170764147 AAGCTCCGCCTCCTTGCAGTGGG - Intergenic
942231665 2:173866399-173866421 CATCTCAGCCCTCTTGCAGTTGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942951163 2:181723592-181723614 CAGCCCAGCCAGCCACCAGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943896097 2:193362217-193362239 CAGCTCAGCAAGACTGCAGCTGG + Intergenic
944580414 2:201127304-201127326 CAGCTCAGGCAGGGTGGAGTTGG + Intronic
944629389 2:201608093-201608115 CAGCTCAGCCAGCAGGTAGTAGG - Intronic
944798999 2:203217298-203217320 CGGCTCAGCCAGATTTCAGCTGG + Exonic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948612745 2:239180150-239180172 CTGCACAGCCAGCTTCCAGGTGG + Intronic
948617718 2:239212258-239212280 CAGCTCAGCCAGGAGGCCGTGGG - Intronic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1171811417 20:29746421-29746443 GATCTCAGCAAGCTTGCAGAAGG + Intergenic
1172527333 20:35607720-35607742 CAGTCCTGCCAGCTTGCAGCTGG - Intergenic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1173893040 20:46528184-46528206 CCTCTTTGCCAGCTTGCAGTTGG + Intergenic
1176553588 21:8242772-8242794 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1176572510 21:8425796-8425818 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1176580419 21:8470357-8470379 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1180149601 21:45940885-45940907 CAGCTCAGGGCTCTTGCAGTAGG - Intronic
1181018521 22:20085345-20085367 CAGATAAGCAAGCATGCAGTGGG - Intronic
1182773754 22:32815850-32815872 TAGCTCTGCCATCATGCAGTGGG - Intronic
1183606455 22:38869215-38869237 AAGCTCAGGCAGTTTGCAGAGGG - Intronic
1184188392 22:42879242-42879264 CTGCCCAGCGAGCCTGCAGTTGG + Intronic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
1203258586 22_KI270733v1_random:159800-159822 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
950274121 3:11643880-11643902 CAGCGCTGCCGGCTTGCAGCGGG - Exonic
950617571 3:14173598-14173620 CACCTCAGCAAACTTACAGTTGG + Intronic
951530663 3:23695229-23695251 CTTCTCTGCCAGCTTGGAGTTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953828244 3:46272692-46272714 CAGCTCACCCAGCTGGCTGAGGG - Intergenic
954999090 3:54910162-54910184 CAGCTCAGGCAGATGGTAGTAGG + Intronic
955666690 3:61356545-61356567 CACCGCACCCAGCTTGTAGTGGG - Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
961872477 3:129998880-129998902 CAGGTCACTCAGCCTGCAGTTGG + Intergenic
962205058 3:133427573-133427595 CTCCTCAGCCAGCTTGGGGTTGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963285471 3:143430749-143430771 CAGCTGAGCCACCTTCCAGGTGG + Intronic
963954654 3:151240342-151240364 CAGCTCAAGCAGTTTCCAGTGGG + Intronic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
965731006 3:171772658-171772680 CAGCTCATCCAGCTTTCGCTTGG - Intronic
970062175 4:12046935-12046957 CACCTCACCCATCTTGCAGCTGG - Intergenic
970356388 4:15257525-15257547 CAGCTCAGCCACTTAACAGTGGG + Intergenic
972579137 4:40379621-40379643 CAGCTCAGCCACAGTCCAGTAGG + Intergenic
973216335 4:47673406-47673428 CAGGTCAGTCAGTTTTCAGTTGG - Intronic
976082831 4:81375370-81375392 CAGCTCAGCCACAATGCAGTAGG - Intergenic
977044462 4:92051536-92051558 CAGCTCAGCCACAATACAGTAGG + Intergenic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
984475739 4:180232151-180232173 CAGCTCAGGCAGTCTGCAGCTGG - Intergenic
984762776 4:183376876-183376898 CAGCTGAGGCATCTGGCAGTGGG - Intergenic
988670671 5:33377674-33377696 CAGGTAAGCCAGCTAGCAGAAGG + Intergenic
990899889 5:60738969-60738991 CAGCTCAGCCATATTACAATAGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
990943709 5:61229151-61229173 CTGCTCACCAAGCTTGCAGGTGG + Intergenic
990984791 5:61631526-61631548 CAGCTGAGCAAGCTGGCATTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994662312 5:102668871-102668893 CAGTGCACCCAGCTTTCAGTAGG - Intergenic
995689082 5:114803328-114803350 CAGGTCAGTCAGCTGGCAGCTGG + Intergenic
999364303 5:151011847-151011869 CAGCAGGGCCAGCTTCCAGTGGG - Intergenic
999428705 5:151508058-151508080 CAGATCAGCCACCTTACAATGGG + Intronic
1002415078 5:179116129-179116151 CAGCTCAGCCAGGGTGGAGGTGG - Intronic
1003501236 6:6704609-6704631 CAGTTCTGCCAGCCTGCAGATGG - Intergenic
1003964849 6:11242982-11243004 CAGCACAGCCTGATTGGAGTTGG - Intronic
1007858154 6:44879330-44879352 CAGCTTAGCCAAGCTGCAGTGGG - Intronic
1008809036 6:55469986-55470008 CAGCTGAGCCAGATGTCAGTGGG + Intronic
1013009488 6:106106675-106106697 TGGCACAGCCAGCTTCCAGTGGG + Intronic
1013625644 6:111934702-111934724 CAGCTTTGCCAACCTGCAGTGGG + Intergenic
1013916683 6:115347691-115347713 CAGCACAGGCTGCTTGCTGTGGG - Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1017005902 6:150027841-150027863 CAGCACAGCCAGGTGACAGTAGG + Intergenic
1017382713 6:153848709-153848731 CAGCTCCTCCTGCTTGCAGGGGG - Intergenic
1019145493 6:169973076-169973098 GAACACAGCCAGCCTGCAGTGGG - Intergenic
1019223157 6:170490889-170490911 CTTCTCAGCCCCCTTGCAGTTGG + Intergenic
1019581787 7:1767800-1767822 CTGCTCATGCAGCTTCCAGTGGG + Intergenic
1019770801 7:2882729-2882751 GAGCTCTGCCAGGTTGCAGGGGG + Intergenic
1022354593 7:29600892-29600914 CAGCTGCTCCAGCTTCCAGTTGG - Intergenic
1023190107 7:37570999-37571021 CAGCCCTGCCAGTTTGCAGGAGG - Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG + Intronic
1029789438 7:102827193-102827215 CAGCTCAGCTAGCTTGCTGGAGG + Intronic
1031395133 7:121264450-121264472 CCTCTCAGCCAGGTTGCATTTGG - Intronic
1042316950 8:67435321-67435343 CAGCTCAGGCAGATGGCAGAAGG + Intronic
1043851538 8:85221596-85221618 CAGCTCAGGCAGAGTGAAGTAGG - Intronic
1044276133 8:90301285-90301307 AAGGTCAGCCTGCCTGCAGTGGG - Intergenic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049379844 8:142306539-142306561 CAGCTCAGCCTGTGTGGAGTTGG - Intronic
1049716000 8:144092470-144092492 CACCTCAGGCAGCTGGCACTGGG + Intergenic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1054786674 9:69216919-69216941 CAGGTCAGAAAGCTGGCAGTTGG - Intronic
1055788668 9:79898421-79898443 TAGGTCAGCCAGGTTGCTGTAGG - Intergenic
1057856941 9:98609307-98609329 CATCACAGTCATCTTGCAGTTGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058372055 9:104280843-104280865 CATCTCAGCCAGCTGGGAGTAGG + Intergenic
1059325982 9:113504247-113504269 CAGCTCAGCAAGCTTGGAAAAGG - Intronic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1060247205 9:121957047-121957069 CAGCTGGGCCAACATGCAGTGGG - Intronic
1060831374 9:126719779-126719801 CAGCTCAGCCAGTCTGCACGGGG + Intergenic
1203474781 Un_GL000220v1:141816-141838 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1186096729 X:6110396-6110418 CAGCCCAGCCCCCTTGCAATTGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1188418650 X:29970010-29970032 CAGATCAGCAAGGTAGCAGTTGG + Intergenic
1188483125 X:30653917-30653939 CAGAGCGGCCCGCTTGCAGTAGG + Intronic
1189284234 X:39840321-39840343 CAGCTCCGCTGGCTTCCAGTTGG + Intergenic
1190151745 X:47955498-47955520 CAGCTCAGCCTGCCCGCACTGGG + Intronic
1190160951 X:48030937-48030959 CAGCTCAGCCTGCCCGCACTGGG - Intronic
1193949350 X:87778817-87778839 CAGCTTTGCCAGGCTGCAGTGGG - Intergenic
1196020322 X:110984477-110984499 CAGCTGAGGCAGCTGGAAGTGGG - Intronic
1200408770 Y:2841384-2841406 CAGCTCAGCCAACTTGACGGGGG + Intergenic
1201076274 Y:10192036-10192058 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1201502423 Y:14659731-14659753 CAGCCCAGCCCCCTTGCAATTGG + Intronic
1202368051 Y:24180084-24180106 CAGCTGGGCCAGCATGCACTGGG + Intergenic
1202502734 Y:25490033-25490055 CAGCTGGGCCAGCATGCACTGGG - Intergenic