ID: 1096547549

View in Genome Browser
Species Human (GRCh38)
Location 12:52351034-52351056
Sequence TTTCTAGCTGGGTCCCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096547544_1096547549 9 Left 1096547544 12:52351002-52351024 CCTCTGGACTTGGGACGGCCACA No data
Right 1096547549 12:52351034-52351056 TTTCTAGCTGGGTCCCTTCAGGG No data
1096547545_1096547549 -9 Left 1096547545 12:52351020-52351042 CCACATCGTTAGAGTTTCTAGCT No data
Right 1096547549 12:52351034-52351056 TTTCTAGCTGGGTCCCTTCAGGG No data
1096547539_1096547549 28 Left 1096547539 12:52350983-52351005 CCTGGGATGGTTGCATGGTCCTC No data
Right 1096547549 12:52351034-52351056 TTTCTAGCTGGGTCCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096547549 Original CRISPR TTTCTAGCTGGGTCCCTTCA GGG Intergenic
No off target data available for this crispr