ID: 1096549323

View in Genome Browser
Species Human (GRCh38)
Location 12:52361782-52361804
Sequence GAGTTGAATCAGATACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096549321_1096549323 -1 Left 1096549321 12:52361760-52361782 CCAATCAAGCTCACAGGAAGGAG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1096549323 12:52361782-52361804 GAGTTGAATCAGATACACCAGGG 0: 1
1: 0
2: 0
3: 9
4: 114
1096549318_1096549323 10 Left 1096549318 12:52361749-52361771 CCTGGATGGTGCCAATCAAGCTC 0: 1
1: 0
2: 3
3: 16
4: 84
Right 1096549323 12:52361782-52361804 GAGTTGAATCAGATACACCAGGG 0: 1
1: 0
2: 0
3: 9
4: 114
1096549317_1096549323 14 Left 1096549317 12:52361745-52361767 CCAGCCTGGATGGTGCCAATCAA 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1096549323 12:52361782-52361804 GAGTTGAATCAGATACACCAGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096549323 Original CRISPR GAGTTGAATCAGATACACCA GGG Intronic
902557136 1:17253624-17253646 GAGTTGAATCAGGTTTCCCAAGG - Intronic
903503995 1:23819953-23819975 AAGTTGGGTCAGATACACTATGG - Intronic
907651198 1:56296352-56296374 GAGTGGAGTCAGACACACCTGGG + Intergenic
907767681 1:57426287-57426309 GTGTTGAATCAAGTCCACCACGG + Intronic
908460890 1:64347630-64347652 GAAATGAAGCAGACACACCAAGG - Intergenic
908933889 1:69350930-69350952 GATTTTAATCAAATGCACCAAGG + Intergenic
911818138 1:102381050-102381072 GAGTTGAGTAAGATAAAGCAAGG - Intergenic
914722378 1:150299951-150299973 GAGATGAATCAGAATCTCCAGGG + Intronic
920175269 1:204097224-204097246 GAGTTGAATCATTTCAACCACGG + Intronic
920683078 1:208087857-208087879 GGGTTTAATCAGATACAATAAGG + Intronic
921452194 1:215322462-215322484 GAGAAGAATGAGATAGACCATGG - Intergenic
923995984 1:239494905-239494927 GAGATGAAGTATATACACCATGG - Intronic
1063483385 10:6396518-6396540 GAGTGGAATCATATACTACATGG + Intergenic
1063830380 10:9945887-9945909 GATTTGAATCACATATATCATGG - Intergenic
1065816179 10:29484879-29484901 CAGTTGAATCAGGTGCAACAGGG + Intronic
1065956722 10:30700017-30700039 CAGTTGAATCAGGTGCAACAGGG - Intergenic
1066542924 10:36468362-36468384 TAGTTCAATCCTATACACCAAGG + Intergenic
1067271615 10:44796512-44796534 GTGTGGAATCAAAGACACCAGGG - Intergenic
1076424400 10:130357264-130357286 GAGCTGCAGCAGATACCCCAGGG + Intergenic
1078134810 11:8643047-8643069 CAGGTGAATCTGATACTCCAAGG + Exonic
1079143347 11:17829130-17829152 AACTGGAATCAGATAGACCAGGG + Intronic
1085869206 11:80329516-80329538 TAGTAGAATTAGATAAACCAGGG - Intergenic
1086529905 11:87772657-87772679 GTTTTGAACCAGATACACCCAGG + Intergenic
1087456526 11:98394038-98394060 GAGTTGAAAATGATATACCAAGG - Intergenic
1087964110 11:104391437-104391459 GAGTTGAATCTGAGAGAACAAGG - Intergenic
1096549323 12:52361782-52361804 GAGTTGAATCAGATACACCAGGG + Intronic
1098089671 12:66887990-66888012 CAGTTGAATCAGAATCACCGGGG - Intergenic
1101085071 12:101227345-101227367 GAATTGAATATGATACATCAGGG - Intergenic
1101220232 12:102631370-102631392 GAGTTGAAGGAAAGACACCAGGG + Intergenic
1102640324 12:114361358-114361380 GAGCTGAATCAGATATTCAAAGG - Intronic
1103261245 12:119591110-119591132 CAGTTGCATCAGAATCACCAGGG + Intergenic
1109089087 13:58016274-58016296 GGATTGAATCAGATTCATCATGG + Intergenic
1109437932 13:62330856-62330878 AAATTGAATAATATACACCACGG + Intergenic
1109662624 13:65484299-65484321 GAGTGGAACAACATACACCAGGG - Intergenic
1110061860 13:71051269-71051291 GAGTAAAATCATATACAGCAAGG - Intergenic
1112634704 13:101202592-101202614 TAGGTGAATCTGATACTCCATGG + Intronic
1115840629 14:37465983-37466005 GAGTTAAATTAGATAAAACAAGG + Intronic
1120166374 14:81205817-81205839 GAGATGAATCAGACACAACATGG - Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1122555993 14:102580410-102580432 AAATCAAATCAGATACACCAGGG + Intergenic
1123180951 14:106469692-106469714 GAATTAAATCAGGCACACCAAGG - Intergenic
1123180959 14:106469813-106469835 GAATTAAATCAGACACACCAAGG - Intergenic
1202945946 14_KI270726v1_random:26966-26988 GAATTAAATCAGACACACCAAGG + Intergenic
1125165447 15:36698924-36698946 GTGTTAAATTAGATTCACCATGG + Intronic
1126202145 15:45998672-45998694 GAGGGGAATGACATACACCAGGG - Intergenic
1128136150 15:65265092-65265114 GACATTAACCAGATACACCAGGG + Intronic
1129626136 15:77201957-77201979 CAGATGAATCAGATGCACAAAGG - Intronic
1130884634 15:88082821-88082843 GAGCTGAATCAGATAAATCAGGG - Intronic
1131807437 15:96137192-96137214 GTATTGAATTAGAAACACCAGGG + Intergenic
1133070175 16:3241449-3241471 GATTAGACTCAGATACTCCATGG - Intergenic
1133653148 16:7832418-7832440 GAGTTGCAGCAGAAACCCCATGG + Intergenic
1151150450 17:72081221-72081243 GAGTGGAACAACATACACCAGGG + Intergenic
1155237490 18:23835328-23835350 GAGATGATTCAGAGTCACCAGGG - Intronic
1157579715 18:48766540-48766562 CAGTTGAATTAGATTCTCCAAGG + Intronic
1158345746 18:56515064-56515086 GAGTTTCATCAGATAAACTACGG + Intergenic
1161812996 19:6481536-6481558 GGCTGGAATCAGATACTCCATGG - Intronic
1164290385 19:23863156-23863178 GCATTAAATCAGATAAACCAGGG - Intergenic
1167672424 19:50861059-50861081 GAGTTCAAGCAGATACAGCATGG + Intergenic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
925166232 2:1717374-1717396 CAGTTGAATCAGATAGCCCCGGG - Intronic
927045888 2:19277748-19277770 GAGGTGAACGACATACACCAGGG - Intergenic
929329587 2:40665188-40665210 CAGTAGAATAAGATACACAAGGG + Intergenic
931845852 2:66203273-66203295 GAGGTGAATCACATTTACCAGGG + Intergenic
932809278 2:74810701-74810723 GAGTCGAATCAGAGAGAGCATGG + Intergenic
935135934 2:100301740-100301762 GAGATGAAGCACATTCACCAAGG - Intronic
935244746 2:101208199-101208221 GAGTGGAATCGGGAACACCAGGG + Intronic
938439456 2:131315182-131315204 GAGGTGAACAACATACACCATGG - Intronic
938575366 2:132598341-132598363 GAGTTGGATAAGAATCACCAAGG + Intronic
940349366 2:152664802-152664824 GAGTTTAATCCTATACACCAGGG + Intronic
941026535 2:160462146-160462168 GATGTGCATCAGATTCACCAGGG + Intronic
943064377 2:183071114-183071136 CAGCTGCATCAGCTACACCAGGG - Intergenic
943898705 2:193403517-193403539 GAGGGGAATCATACACACCAGGG + Intergenic
946993749 2:225366787-225366809 GAGTTGTAACAGAGACAACAAGG + Intergenic
1168990565 20:2092218-2092240 CTTTGGAATCAGATACACCAGGG + Intergenic
1172665171 20:36594103-36594125 GAGTTGAATGGGATACAGAATGG - Intronic
1174411290 20:50338308-50338330 GATTTAAATCAGACAGACCAGGG - Intergenic
1177009924 21:15719572-15719594 GAATTGGAAAAGATACACCATGG - Intergenic
949119407 3:367811-367833 GAGGTGAATCACACATACCAGGG - Intronic
949578372 3:5361059-5361081 GACCTGAATCAGAAACTCCAGGG + Intergenic
952433158 3:33245908-33245930 GAGTTGAATAAGATTGAACATGG + Intergenic
955526003 3:59820402-59820424 GCTTTGAATCAGAATCACCATGG - Intronic
955742990 3:62112043-62112065 GGGTTGTACCAGAAACACCATGG + Intronic
956903270 3:73739222-73739244 GAATTGAATGAGATAATCCATGG + Intergenic
957436608 3:80185358-80185380 GAGTTCAATCAGTAACAACAGGG + Intergenic
958421004 3:93931291-93931313 AAGTTAAATCAGGTACATCATGG - Intronic
961728208 3:128946820-128946842 TAGTGAAATCAGATGCACCAAGG + Intronic
966328777 3:178788102-178788124 GAGTTAAACCACATTCACCATGG + Intronic
970368313 4:15383427-15383449 GAGTTGTATCAGATACTGAAAGG - Intronic
973194498 4:47424235-47424257 GCTTTGAATCAGATACACATGGG + Intronic
983802176 4:171946482-171946504 GAGATGAATAACATCCACCAAGG - Intronic
988421944 5:31016539-31016561 GATGTGAATAAGATACACTAGGG + Intergenic
992691225 5:79242223-79242245 GAGTGGAGTCAGAAACACCTAGG + Intronic
1000155174 5:158543678-158543700 GAGTGGTATCAGATTCAGCAAGG - Intergenic
1003682816 6:8272531-8272553 GAGATGAGTTAGATATACCAGGG - Intergenic
1004126571 6:12879843-12879865 GGGATGAATCAGATCCACAATGG + Intronic
1005746235 6:28840709-28840731 GAGTAGAATCATAGATACCAGGG + Intergenic
1011553004 6:88547090-88547112 GACTTGCATCTTATACACCAAGG + Intergenic
1012392852 6:98762671-98762693 GAGGTGAACAATATACACCAGGG - Intergenic
1012937080 6:105379607-105379629 GAGATGAAGCAGATCCACCCAGG + Intronic
1012963105 6:105643780-105643802 GAGTAGACTCAGATCCCCCAGGG + Intergenic
1021658061 7:22891535-22891557 GTGTTGAATCAGAGACGCCTTGG + Intergenic
1022277732 7:28872528-28872550 GACTTGAGTCAGATATACCTGGG - Intergenic
1025942031 7:66081965-66081987 GAGATGGACCAGATACTCCATGG + Exonic
1028800459 7:94958399-94958421 GAGGTGAATGAGATAGACAAGGG - Intronic
1030205120 7:106944948-106944970 GTGTTGAATAAAATACTCCAAGG + Intergenic
1031185052 7:118467071-118467093 CAGTTGAGTTAGATACAACAAGG + Intergenic
1031389721 7:121199277-121199299 GAGTTGAATCTAATTCTCCAAGG - Intronic
1032917176 7:136505005-136505027 GAGTGTAGTCGGATACACCAAGG + Intergenic
1033143070 7:138844831-138844853 GAATTGAAACAGAAACACTAGGG + Intronic
1034692813 7:153027519-153027541 AAGTTAGATCATATACACCAAGG + Intergenic
1034855492 7:154542280-154542302 GAGTTGAATCAGATTCTCTTAGG - Intronic
1041102616 8:54411776-54411798 GATTTGAATGAGACACACCAAGG - Intergenic
1044505503 8:93012890-93012912 GTATTGAATCAGAAACAACAAGG + Intronic
1046110383 8:109716049-109716071 AAGTGGAATCATATACACCTAGG - Intergenic
1048327576 8:133451132-133451154 GAGTTGAATGAGATGGTCCAAGG - Intergenic
1058374900 9:104311241-104311263 GAGGGGAATAACATACACCATGG + Intergenic
1060732913 9:126049404-126049426 GAGCAGAATCAGACAGACCAGGG + Intergenic
1185872684 X:3677161-3677183 TAGTTGAACAAGATAAACCATGG + Intronic
1194799889 X:98259784-98259806 GACTGGAATCAGATACACCTGGG + Intergenic
1195096051 X:101502180-101502202 GAGTTCTGTCAGATCCACCAAGG + Intronic
1196630505 X:117933917-117933939 AAGATGGATCATATACACCATGG + Intronic
1196970553 X:121103634-121103656 GAGATAAATCAAATACAGCATGG - Intergenic
1197572435 X:128165779-128165801 GAGTACAAACAGAGACACCATGG + Intergenic
1197627091 X:128814347-128814369 TAGTTGAATGAGATACAACGTGG + Intergenic