ID: 1096549400

View in Genome Browser
Species Human (GRCh38)
Location 12:52362385-52362407
Sequence CAGCTCAGCCAGCTTGCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 4, 2: 5, 3: 21, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096549391_1096549400 11 Left 1096549391 12:52362351-52362373 CCATGTCCTGCTTGGCCTTCTGC 0: 9
1: 7
2: 20
3: 129
4: 701
Right 1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG 0: 1
1: 4
2: 5
3: 21
4: 290
1096549389_1096549400 26 Left 1096549389 12:52362336-52362358 CCTTGAGCAGGCAGGCCATGTCC 0: 2
1: 3
2: 1
3: 14
4: 190
Right 1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG 0: 1
1: 4
2: 5
3: 21
4: 290
1096549394_1096549400 5 Left 1096549394 12:52362357-52362379 CCTGCTTGGCCTTCTGCAGGGCG 0: 3
1: 11
2: 16
3: 38
4: 274
Right 1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG 0: 1
1: 4
2: 5
3: 21
4: 290
1096549395_1096549400 -4 Left 1096549395 12:52362366-52362388 CCTTCTGCAGGGCGCCCTCCAGC 0: 3
1: 5
2: 27
3: 58
4: 305
Right 1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG 0: 1
1: 4
2: 5
3: 21
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096549400 Original CRISPR CAGCTCAGCCAGCTTGCAGC GGG Exonic
900115684 1:1026873-1026895 CAGCTCACCCAGCAGGCAGGAGG - Intronic
900666025 1:3816062-3816084 CTGCACAGCCAGTTTGCAGGTGG + Intronic
900892290 1:5458271-5458293 CAGCTCTGATAGCTTGAAGCTGG - Intergenic
902608615 1:17583601-17583623 CAGCTCACCCAGGTACCAGCTGG - Intronic
902702624 1:18182992-18183014 CTGGGCAGCCAGTTTGCAGCGGG - Intronic
902926383 1:19698444-19698466 CACCTCAGCTAGCTTCCAGAAGG + Intronic
903185307 1:21625475-21625497 CTGGTCAGACAGCTTGCATCCGG + Intronic
903344886 1:22677560-22677582 CAGCTCTGCCACATCGCAGCTGG - Intergenic
904338379 1:29812577-29812599 CAGCTCTGCCAGAGTCCAGCTGG - Intergenic
905884996 1:41486983-41487005 CAGCACAGCCAGCTGCGAGCTGG + Intergenic
906267851 1:44447835-44447857 CAGCACAGGCAGCATGAAGCAGG - Intronic
907568410 1:55459201-55459223 CAGCTCAACCAGTTTGTAACAGG - Intergenic
910227516 1:84951087-84951109 CACCCCAGAGAGCTTGCAGCTGG + Intronic
910258950 1:85277400-85277422 CACCTCAGCCACCAAGCAGCTGG + Intergenic
910332133 1:86086323-86086345 TAGGTCAGCCAACTTGGAGCTGG - Intronic
911806237 1:102211441-102211463 CATCTCAGGGAGCCTGCAGCAGG + Intergenic
912400289 1:109385557-109385579 CGGCTCAGTCAGCTGGCAACTGG - Intronic
915832133 1:159140961-159140983 AAGCTCATCCAGCTTGCTGCTGG + Intronic
918096642 1:181341565-181341587 CAGCTCAACCAGCCTGCAAGGGG + Intergenic
918523064 1:185436116-185436138 GTGCTCAGCCAGGCTGCAGCAGG - Intergenic
918557207 1:185817148-185817170 CAGCTCACCCAGAGTCCAGCAGG + Intronic
918728233 1:187953653-187953675 CTGGTCATCCAGCTTGCAGACGG - Intergenic
919795440 1:201318858-201318880 CATCTCAGCCAACATTCAGCCGG + Intronic
919926163 1:202192964-202192986 CAGCTCAGCCACCCTGAGGCTGG - Intergenic
920200882 1:204259140-204259162 CAACTCAGCCTGCTTCCAGAAGG + Intronic
920203784 1:204276917-204276939 CAGCTCATCCTGCTTGGATCCGG - Intronic
920458157 1:206116723-206116745 CAGCACAGCCAGGTTGCCCCCGG + Exonic
922346889 1:224703822-224703844 CAGCTCATTCAGCCCGCAGCAGG + Intronic
923066006 1:230517987-230518009 CAGCTCAGCCAGCTTAGTCCAGG - Intergenic
1063419396 10:5899219-5899241 CAGCTAAGCAGGCCTGCAGCTGG + Intronic
1065160166 10:22911456-22911478 CAGCCCAGTCTGCTTGCATCTGG - Intergenic
1067078223 10:43199984-43200006 CAGCACAGCCATCTTGGAGCAGG + Intronic
1067112941 10:43413435-43413457 CAGCTCAGCCATCTAGAAGCTGG - Intergenic
1067268079 10:44764769-44764791 CAGCTCAGCCAGCTGCAACCAGG - Intergenic
1067281782 10:44878899-44878921 CAGCTCAGCCAGGCTGAGGCAGG - Intergenic
1068511287 10:57968757-57968779 CAGCTCAGCAAGCCAGCACCTGG + Intergenic
1068977279 10:63023429-63023451 CAGGTCAGCAAGCCTGCAGCTGG - Intergenic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1069627084 10:69875010-69875032 CAGCTAACCCAGTTTGCAGCGGG - Intronic
1069678960 10:70270259-70270281 CAGCACTGCCTGCCTGCAGCAGG - Intronic
1070815941 10:79323308-79323330 CAGCCCAGCCAGAGTGCTGCTGG + Intergenic
1071491946 10:86142161-86142183 GAGTTCAGCTGGCTTGCAGCTGG - Intronic
1074434383 10:113421439-113421461 TGGCCAAGCCAGCTTGCAGCAGG - Intergenic
1075221577 10:120589454-120589476 CAGCGCACCCAGCTTGCCTCTGG + Exonic
1075869865 10:125763419-125763441 CTGCTGGGCCAGCTTGCCGCCGG + Exonic
1076467807 10:130697106-130697128 TAGCTCAGCCAGCGGGCTGCTGG - Intergenic
1076571825 10:131438229-131438251 CAGCTCTGCCAGCGGGCATCTGG - Intergenic
1076887969 10:133271239-133271261 CCCCTCAGCCAGCTGGCAGGTGG + Exonic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077739844 11:4833619-4833641 CAGCTCAACAGGCTTGCAGCAGG - Intronic
1078136715 11:8657881-8657903 CAGATAAGCCTGCTGGCAGCTGG - Intronic
1078540930 11:12212360-12212382 CACCTCAGCCAGCAAGTAGCTGG - Intronic
1078610182 11:12813090-12813112 CAGTCCAGCCGGCTTGGAGCTGG + Intronic
1080050688 11:27856006-27856028 CAGCTAAGCCAGCCTACTGCAGG - Intergenic
1080059260 11:27939706-27939728 CAGTTCTCCCAGCATGCAGCTGG + Intergenic
1081443101 11:43101389-43101411 CAGCTCACCCATCTGGTAGCTGG + Intergenic
1081568509 11:44275438-44275460 CAGCTCCTCCAGCTGGTAGCTGG + Exonic
1081829143 11:46091755-46091777 CAAGTCATCCAGCTTGAAGCTGG - Intronic
1083273731 11:61585417-61585439 CTGCACAGCCAACTTCCAGCTGG - Intergenic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1084153389 11:67301613-67301635 CAGCAGAGCCTGCTTGAAGCGGG + Exonic
1084399201 11:68933857-68933879 CAGCTCAAACAGCCCGCAGCCGG - Exonic
1085121929 11:73973017-73973039 CAGCTCAGCCAGGCTGCAGGGGG - Intergenic
1085247013 11:75110015-75110037 GGTCCCAGCCAGCTTGCAGCAGG + Intronic
1088583132 11:111334485-111334507 CTGCTCAGCCAGCGCTCAGCAGG - Intergenic
1089225858 11:116921015-116921037 CAGCTCACTCAGCATGGAGCCGG - Intronic
1090247484 11:125226840-125226862 CAGCTGGGCCAGCCTGCAACAGG - Intronic
1090408080 11:126489305-126489327 CAGCTCAGCCTGCACGGAGCAGG + Intronic
1090424447 11:126597303-126597325 CAGCCTTGTCAGCTTGCAGCGGG - Intronic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1093281914 12:17204823-17204845 CAGCTCCGGCAGCTGGCAACAGG - Intergenic
1093604556 12:21074091-21074113 CATCTCAGGGAGCCTGCAGCTGG + Intronic
1095736866 12:45567166-45567188 CAGCTCTGCCACCTAACAGCTGG + Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096552205 12:52380497-52380519 CAGATCTGCCAGCTTGCATTTGG + Exonic
1096554706 12:52396146-52396168 CAGCCCTGCCAGCTTGCACTTGG + Exonic
1096569957 12:52516771-52516793 CAGCTCGGCCAGCTTGTTCCTGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1098140098 12:67442517-67442539 CAGCTTTGCCAGCCTGGAGCCGG + Intergenic
1099421996 12:82473214-82473236 TGGGTCAGCCAGCTTGGAGCTGG + Intronic
1101695612 12:107122825-107122847 CACCTCCAGCAGCTTGCAGCCGG - Intergenic
1102104227 12:110306874-110306896 CACCTCAGCCTCCTTGTAGCTGG + Intronic
1102950681 12:117028681-117028703 CAGCTCTACCAGCTTGCTACTGG - Intronic
1104874416 12:132023899-132023921 CAGCTCCGGCAGCTCACAGCGGG + Exonic
1105330189 13:19408872-19408894 CAGCTGAGCCAGCTTTCCACTGG - Intergenic
1105861616 13:24420177-24420199 CAGCTGAGCCAGCTTTCCACTGG + Intergenic
1105918278 13:24937706-24937728 CAGCTGAGCCAGCTTTCCACTGG - Intergenic
1106082723 13:26513961-26513983 AAGGTCAGCCAGATTGCAGTTGG + Intergenic
1106335280 13:28778012-28778034 GAGCACACCCAGCCTGCAGCCGG - Intergenic
1107103081 13:36614834-36614856 CAGCTCAGTGAACATGCAGCTGG + Intergenic
1109925047 13:69126408-69126430 CAGCTCAGGCAGCTTCAGGCTGG + Intergenic
1110577118 13:77070307-77070329 AAGCTCATCCAACCTGCAGCCGG + Intronic
1112203766 13:97303504-97303526 CACCCCAGCCAGCTAGCTGCCGG + Intronic
1113156758 13:107332246-107332268 CAAATCACCCAGCTTGCAGAAGG + Intronic
1114398127 14:22385119-22385141 CAGCTAAGCCAACAAGCAGCTGG + Intergenic
1118092623 14:62498795-62498817 CAGCTCAGTCACCTTCCACCAGG + Intergenic
1119211485 14:72835558-72835580 CAGTTTCTCCAGCTTGCAGCAGG + Intronic
1119761481 14:77155070-77155092 CAGGTCACCCAGCTTGTAGGTGG + Intronic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1120870891 14:89336572-89336594 CAGGTCACACAGCTTGCAGATGG - Intronic
1121291213 14:92777132-92777154 CAGCTCAGCCTTCTTGCCTCTGG + Intergenic
1122922970 14:104887530-104887552 TAGCTCAGCCAGCTCCCAGAAGG + Exonic
1123125195 14:105941214-105941236 CAGATCAGCCAGCCTGCAGTGGG - Intergenic
1124204746 15:27707640-27707662 CAGCTCTGCCAGCTTATTGCTGG + Intergenic
1125501199 15:40241184-40241206 CAGGTCATCCACCCTGCAGCAGG - Intronic
1125525474 15:40371399-40371421 CATCTCAGCCAGATTCCAGAGGG - Intergenic
1128563133 15:68681744-68681766 CCACTCAGCCAGTGTGCAGCAGG - Intronic
1133042229 16:3066827-3066849 CAGCTGAGCCAGCCTGCTCCAGG + Intronic
1135080098 16:19426823-19426845 CAGATCAGCCAGCGAGGAGCAGG - Intronic
1136288916 16:29260056-29260078 CACCCCAGCCAGCCTGCACCCGG - Intergenic
1139514251 16:67444053-67444075 CAGGTCAGACAGCATCCAGCAGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140745299 16:77975545-77975567 CTGCCCAGCCAGCATGCTGCAGG + Intronic
1140937965 16:79692513-79692535 CAGCAAAGCCAGCATGCACCAGG - Intergenic
1141276380 16:82592330-82592352 CAGCTCATCAAACTTGCACCAGG + Intergenic
1141461931 16:84182949-84182971 CAGCTCAGACTGCATGGAGCAGG + Intronic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1142094644 16:88232963-88232985 CACCCCAGCCAGCCTGCACCCGG - Intergenic
1142365232 16:89646584-89646606 CAGCTCAGCCAGCTGCCCGAGGG - Exonic
1143356255 17:6331041-6331063 CAGCTCAGCCAGGCAGCAGGAGG + Intergenic
1143723058 17:8827172-8827194 CATCTCAGCCAGCTTGTGGATGG + Exonic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1151277117 17:73043518-73043540 CAGCTTAGCCAGCATGGAGCAGG + Intronic
1151892993 17:76962107-76962129 CAGGCGAGCCAGATTGCAGCCGG + Intergenic
1152206177 17:78975903-78975925 CAGCACAGCCAGCTCCCAGGAGG - Intronic
1152235084 17:79134490-79134512 CAGCTCTGCAGCCTTGCAGCTGG + Intronic
1152267745 17:79306179-79306201 CAGCTCTGCCAGTTCCCAGCTGG + Intronic
1152375072 17:79914703-79914725 CTGCTCAGCCCCCGTGCAGCTGG - Intergenic
1152520685 17:80854402-80854424 CAGCTCAGGCAGCAGGAAGCTGG + Intronic
1157538098 18:48475891-48475913 CTGCTCATCCACCCTGCAGCTGG - Intergenic
1157813548 18:50715176-50715198 CATCTCAGCCAGGATGCAGCCGG - Exonic
1158489683 18:57898667-57898689 CTGTGCTGCCAGCTTGCAGCAGG - Intergenic
1158641506 18:59207670-59207692 AAGCTCACACAGTTTGCAGCCGG + Intergenic
1160152420 18:76405484-76405506 GAGCACAGCCAGCAGGCAGCAGG + Intronic
1160620510 18:80167414-80167436 CAGGGCAGCAAGCTTGGAGCAGG + Intronic
1160832228 19:1109385-1109407 CTGCTCCGCCAGCAGGCAGCTGG + Exonic
1161347601 19:3776042-3776064 CTTCTCAGCCAACTTGCAGAAGG + Intergenic
1162084805 19:8242071-8242093 CAGCTCAGAGACCTTGCACCTGG - Intronic
1162328896 19:10014900-10014922 CAGCTCTGCTACTTTGCAGCTGG - Intronic
1163130075 19:15266872-15266894 CAGCTCTGCCAGCTGGCCCCTGG + Intronic
1163802224 19:19373241-19373263 CAGCCCAGCCAGCTGGTAGGAGG - Intergenic
1163820425 19:19493412-19493434 GAGCTCAGCACACTTGCAGCTGG - Intronic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1165896737 19:39145915-39145937 CAGCTCCGCCACCTTCTAGCTGG + Intronic
1165898584 19:39157465-39157487 CGGCTCAGCCAGCCTGCACATGG - Intronic
1166253413 19:41586255-41586277 CAGCTCAGCCAGATGCCAGTGGG - Intronic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1166863863 19:45824647-45824669 CTGCTCTTCCAGTTTGCAGCAGG - Intronic
1167358518 19:49017979-49018001 CAGCTATGGCAGCTTGAAGCCGG - Intergenic
1167644569 19:50698766-50698788 CAGCTCAGTCTGCTTCCAGAGGG + Intronic
927074094 2:19559730-19559752 CAGTTCAGCCAGGTGGCATCAGG - Intergenic
927129032 2:20041647-20041669 CACCTCAGCCACCTGGTAGCTGG + Intronic
927202425 2:20586303-20586325 GAGCACAGCCACCTTGAAGCTGG + Intronic
927677297 2:25115384-25115406 CAGCTCAACCCGCTTGCGACAGG - Intronic
927787071 2:25981699-25981721 CAGGTCGGCCTGCTTGGAGCTGG + Exonic
928321008 2:30282856-30282878 CAGCTCAGGCAGCTCCCAGGGGG + Intronic
929269442 2:39957659-39957681 CATCTCTGCCAGCTTCCATCTGG + Intergenic
930744133 2:54863405-54863427 CACCTCAGCCTCCTGGCAGCTGG - Intronic
930745762 2:54881860-54881882 CAGCACAGCCAGCCAGAAGCAGG - Intronic
935920950 2:108013788-108013810 CAAATCAGCAAGCTTGTAGCTGG + Exonic
937222962 2:120352690-120352712 CAGCACAGCCAGCTGGTGGCAGG + Intergenic
942231665 2:173866399-173866421 CATCTCAGCCCTCTTGCAGTTGG + Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943896097 2:193362217-193362239 CAGCTCAGCAAGACTGCAGCTGG + Intergenic
944629389 2:201608093-201608115 CAGCTCAGCCAGCAGGTAGTAGG - Intronic
944798999 2:203217298-203217320 CGGCTCAGCCAGATTTCAGCTGG + Exonic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947525797 2:230876022-230876044 CATGACAGCCAGCGTGCAGCTGG - Intronic
948501938 2:238401686-238401708 CTGCTCATCCTGCTTGCTGCTGG - Intergenic
948612745 2:239180150-239180172 CTGCACAGCCAGCTTCCAGGTGG + Intronic
948834704 2:240620407-240620429 CAGCTCTGCCCACCTGCAGCAGG - Intronic
1170143816 20:13151492-13151514 CAACTCTGCCAGCTCCCAGCAGG - Intronic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1171811417 20:29746421-29746443 GATCTCAGCAAGCTTGCAGAAGG + Intergenic
1172527333 20:35607720-35607742 CAGTCCTGCCAGCTTGCAGCTGG - Intergenic
1173863078 20:46297037-46297059 CAACTCAGCCAGCTTCAGGCTGG - Intronic
1175671023 20:60902969-60902991 CAGCTCATCCTCCATGCAGCTGG + Intergenic
1175671039 20:60903056-60903078 CAGCTCATCCTCCATGCAGCTGG + Intergenic
1175671054 20:60903143-60903165 CAGCTCATCCTCCATGCAGCTGG + Intergenic
1175818601 20:61896487-61896509 CAGCTCAGCCCCACTGCAGCAGG + Intronic
1176013987 20:62919050-62919072 AAGCTCCACCAGCTTGCGGCAGG + Intronic
1176074686 20:63243067-63243089 CTGCACAGCCAGCAGGCAGCAGG + Intronic
1176553588 21:8242772-8242794 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1176572510 21:8425796-8425818 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1176580419 21:8470357-8470379 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1178127355 21:29529528-29529550 CATCTCAGCTAGTTTGCTGCAGG + Intronic
1179042919 21:37820368-37820390 CAGCACACCCAGCTTTGAGCAGG - Intronic
1180564700 22:16652975-16652997 CAGCTGAGCCAGCTTTCCACTGG + Intergenic
1181029590 22:20143376-20143398 CAGCTCCTACAGCCTGCAGCAGG + Exonic
1181283460 22:21735951-21735973 GAGCTCCGCCAGCTCGCACCCGG + Intergenic
1181513664 22:23399942-23399964 CAGCTCCTACAGCCTGCAGCAGG - Intergenic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182811552 22:33121242-33121264 CAGCTAGGCCAGTTGGCAGCTGG - Intergenic
1183606455 22:38869215-38869237 AAGCTCAGGCAGTTTGCAGAGGG - Intronic
1183953617 22:41366679-41366701 CAGCTCTGCCAGCCTGCTTCAGG - Intergenic
1184425952 22:44409449-44409471 CAGCCAAGCCAGCCTGCTGCAGG + Intergenic
1184893736 22:47394929-47394951 CAGCCCAGCCAGTTTCTAGCTGG - Intergenic
1185137966 22:49084116-49084138 CAGCTCAGAGAGCAGGCAGCTGG + Intergenic
1203258586 22_KI270733v1_random:159800-159822 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
949889950 3:8726331-8726353 CTGGTCAGCCAACATGCAGCTGG - Intronic
950274121 3:11643880-11643902 CAGCGCTGCCGGCTTGCAGCGGG - Exonic
953071812 3:39527929-39527951 CAGCTCAGCCATCCTGAAACCGG - Intronic
953828244 3:46272692-46272714 CAGCTCACCCAGCTGGCTGAGGG - Intergenic
956538729 3:70309554-70309576 CAGCTCAGCCATCTACTAGCTGG - Intergenic
958675456 3:97264434-97264456 TAGCTCCTCCAGCTGGCAGCAGG + Intronic
959685387 3:109140416-109140438 AAGCTCAGGCCGTTTGCAGCGGG - Intergenic
963285471 3:143430749-143430771 CAGCTGAGCCACCTTCCAGGTGG + Intronic
965256743 3:166423946-166423968 CGGCTCTCTCAGCTTGCAGCGGG + Intergenic
965442230 3:168729290-168729312 CAGATCAGCCAGCTAGGTGCTGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
966876351 3:184324081-184324103 CAGCTCTGCCTCCTTCCAGCTGG - Intronic
968532620 4:1101794-1101816 CACCTAAGAAAGCTTGCAGCAGG + Intronic
968568390 4:1326915-1326937 CAGAGAAGCAAGCTTGCAGCAGG - Intronic
968888748 4:3354169-3354191 CTGCCCAGCCAGCTTGCCCCAGG + Intronic
968914884 4:3493100-3493122 CTGCTCAGCCTGCCAGCAGCGGG + Exonic
968954980 4:3713678-3713700 CAGCTCAGCCGTCAGGCAGCAGG + Intergenic
969325641 4:6442312-6442334 CAGCTCTGCCCGCTCTCAGCAGG + Intronic
969696421 4:8737677-8737699 CAGCTCTGCCTGCTGGCGGCTGG + Intergenic
970062175 4:12046935-12046957 CACCTCACCCATCTTGCAGCTGG - Intergenic
970065654 4:12090619-12090641 CAGTTCTCCCAGCATGCAGCTGG + Intergenic
976082831 4:81375370-81375392 CAGCTCAGCCACAATGCAGTAGG - Intergenic
976397544 4:84572423-84572445 CATCTCAGGCAGGTGGCAGCAGG - Intergenic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
979059737 4:116042855-116042877 CAGCCAAGCCAGCTTCCACCTGG - Intergenic
984475739 4:180232151-180232173 CAGCTCAGGCAGTCTGCAGCTGG - Intergenic
984771605 4:183441470-183441492 CAGAAAAGCCAGCTTGCCGCTGG + Intergenic
985475518 5:76783-76805 CAGCAGAGCCTGCTGGCAGCGGG + Intergenic
985589694 5:758095-758117 CAGCTCAGCCTGCAGGGAGCGGG - Intronic
985686228 5:1283134-1283156 CAGCACATCCAGCTCACAGCAGG + Intronic
985686282 5:1283377-1283399 CAGCACATCCAGCTCACAGCAGG + Intronic
985686431 5:1283991-1284013 CAGCACATCCAGCTCACAGCAGG + Intronic
985686445 5:1284052-1284074 CAGCACATCCAGCTCACAGCAGG + Intronic
988670671 5:33377674-33377696 CAGGTAAGCCAGCTAGCAGAAGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
990943709 5:61229151-61229173 CTGCTCACCAAGCTTGCAGGTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994670973 5:102761098-102761120 CAGCACAGCTGGGTTGCAGCAGG - Intronic
995689082 5:114803328-114803350 CAGGTCAGTCAGCTGGCAGCTGG + Intergenic
999229548 5:150053589-150053611 CAGCTCAGGCCCCTTGGAGCAGG - Exonic
1001135432 5:169098881-169098903 CAGCACAGCCACATTCCAGCGGG + Intronic
1001749710 5:174119382-174119404 CAGCTTGACCAGCTTGCATCTGG - Intronic
1002415078 5:179116129-179116151 CAGCTCAGCCAGGGTGGAGGTGG - Intronic
1003501236 6:6704609-6704631 CAGTTCTGCCAGCCTGCAGATGG - Intergenic
1005128041 6:22471225-22471247 AAACTCAGGCAGCCTGCAGCTGG + Intergenic
1007321006 6:41028651-41028673 CAGCCCAGGGAGCCTGCAGCAGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1017382713 6:153848709-153848731 CAGCTCCTCCTGCTTGCAGGGGG - Intergenic
1017755694 6:157527165-157527187 CAGCTGAGCCACCCTGCAACTGG + Intronic
1018317547 6:162571690-162571712 CAGCTCAGGCACCTTGCTCCTGG - Intronic
1018591072 6:165423372-165423394 CAGCTGAGCCACCTGGCCGCAGG + Intronic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019090742 6:169530686-169530708 CAGCTCAGCCTTCTTGAGGCCGG + Intronic
1019257024 7:59129-59151 CAGCTCAGCCGGGAGGCAGCAGG + Intergenic
1019473603 7:1233583-1233605 CAGCTCCTCCAGCTGCCAGCCGG - Exonic
1019489894 7:1307410-1307432 AAGCTCATCCCCCTTGCAGCAGG - Intergenic
1019598498 7:1869463-1869485 GAGCTCAGCCCACGTGCAGCTGG + Intronic
1019770801 7:2882729-2882751 GAGCTCTGCCAGGTTGCAGGGGG + Intergenic
1023190107 7:37570999-37571021 CAGCCCTGCCAGTTTGCAGGAGG - Intergenic
1026736050 7:72949395-72949417 CTCCTCAGCCAGCTCACAGCAGG + Exonic
1027107678 7:75415666-75415688 CTCCTCAGCCAGCTCACAGCAGG - Intergenic
1029789438 7:102827193-102827215 CAGCTCAGCTAGCTTGCTGGAGG + Intronic
1032239038 7:130147290-130147312 CACCTCAGCCCCCTAGCAGCTGG - Intergenic
1034410277 7:150937596-150937618 CATCCCATCCAGCCTGCAGCAGG + Intergenic
1034854111 7:154524512-154524534 CAGATCAGCCAACATCCAGCTGG - Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1037539500 8:19857537-19857559 CAGATCAGCCCGCTCCCAGCAGG + Intergenic
1038665331 8:29532518-29532540 CAGCTCAGCCTCTCTGCAGCAGG + Intergenic
1038914895 8:32010031-32010053 TAGCTCAGCCTGCAAGCAGCAGG - Intronic
1041289069 8:56291230-56291252 CAGCTTAGCAAGCCTCCAGCTGG + Intergenic
1042316950 8:67435321-67435343 CAGCTCAGGCAGATGGCAGAAGG + Intronic
1042332504 8:67595375-67595397 CAGTTCTCCCAGCATGCAGCTGG - Intronic
1044055542 8:87565679-87565701 CAGCTCTTCAAGCTTGAAGCTGG + Intronic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1045657299 8:104400072-104400094 GACCCCAGGCAGCTTGCAGCAGG - Intronic
1048341147 8:133539327-133539349 CAGCTCACCCGGCAGGCAGCAGG + Intronic
1049183339 8:141234826-141234848 CAGCACAGCCAGGCTCCAGCAGG + Intronic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049402335 8:142434021-142434043 CAGAACAGCCAGGGTGCAGCAGG - Intergenic
1049707400 8:144049250-144049272 CTCCTCAGCCACCCTGCAGCTGG - Intergenic
1049728987 8:144166356-144166378 CAGTTCAGCCTGCTCGGAGCGGG + Intronic
1049960645 9:734902-734924 CAGCTCGGGCAGCCTACAGCTGG - Intronic
1051296371 9:15600624-15600646 CAGTTCTCCCAGCATGCAGCTGG - Intronic
1052813475 9:33082147-33082169 GAGACCAGCCAGCTTCCAGCTGG - Intergenic
1053366319 9:37524937-37524959 AAGCACAGCCACCATGCAGCTGG + Intronic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1057317255 9:93977624-93977646 CAACCCAGCCAGCTGTCAGCAGG - Intergenic
1057485867 9:95483633-95483655 CAGCTGCGCCAGGTTTCAGCAGG - Intronic
1057515163 9:95714416-95714438 GAGCACTACCAGCTTGCAGCTGG - Intergenic
1057976362 9:99609866-99609888 CAGCCCCGCCATCATGCAGCTGG + Intergenic
1058372055 9:104280843-104280865 CATCTCAGCCAGCTGGGAGTAGG + Intergenic
1059325982 9:113504247-113504269 CAGCTCAGCAAGCTTGGAAAAGG - Intronic
1059434330 9:114267108-114267130 CAGCTTAGCCAGCGTGAGGCGGG - Intronic
1060831374 9:126719779-126719801 CAGCTCAGCCAGTCTGCACGGGG + Intergenic
1061490827 9:130943343-130943365 GTGCTGAGCCAGCATGCAGCAGG + Intergenic
1062020634 9:134317878-134317900 CACCCCAGCCAGCTCACAGCAGG + Intronic
1062020653 9:134317951-134317973 CACCCCAGCCAGCTCACAGCAGG + Intronic
1062020664 9:134317988-134318010 CACCCCAGCCAGCTCACAGCAGG + Intronic
1062020676 9:134318025-134318047 CAACCCAGCCAGCTCACAGCAGG + Intronic
1062059485 9:134487314-134487336 CAGCTCTGCCTGCATGGAGCAGG - Intergenic
1062228063 9:135465035-135465057 CAGCTAAACCAGCCTGGAGCTGG - Intergenic
1203474781 Un_GL000220v1:141816-141838 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187356450 X:18577278-18577300 CAGCTCAGCCATTTACCAGCAGG - Intronic
1188084153 X:25882784-25882806 CAGCTCAGCAAGGCTGCTGCAGG + Intergenic
1190822518 X:53986824-53986846 CAGCTCAGCCTTCTAGTAGCTGG - Intronic
1191221470 X:57991970-57991992 CAGCTCAGTCCTCTAGCAGCAGG + Intergenic
1192214458 X:69149077-69149099 CAGCTCTGCCACTTGGCAGCTGG - Intergenic
1194876296 X:99192557-99192579 CAGCTCTGCCAGCATCTAGCTGG - Intergenic
1199694589 X:150334858-150334880 CATCTCACCCAACTTGCATCTGG - Intergenic
1200408770 Y:2841384-2841406 CAGCTCAGCCAACTTGACGGGGG + Intergenic
1201076274 Y:10192036-10192058 GATCTCAGCAAGCTTGCAGAAGG - Intergenic
1201343296 Y:12956567-12956589 CAGCTAAACCAGGTGGCAGCTGG + Intergenic