ID: 1096551473

View in Genome Browser
Species Human (GRCh38)
Location 12:52376333-52376355
Sequence ATGTCCCAGCAGAGGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096551473_1096551475 -10 Left 1096551473 12:52376333-52376355 CCTTCACACCTCTGCTGGGACAT 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1096551475 12:52376346-52376368 GCTGGGACATTATATCCTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 98
1096551473_1096551481 23 Left 1096551473 12:52376333-52376355 CCTTCACACCTCTGCTGGGACAT 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1096551481 12:52376379-52376401 TGTTGCCCCAAGTCTGGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1096551473_1096551477 17 Left 1096551473 12:52376333-52376355 CCTTCACACCTCTGCTGGGACAT 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1096551477 12:52376373-52376395 ATTTAATGTTGCCCCAAGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 103
1096551473_1096551479 21 Left 1096551473 12:52376333-52376355 CCTTCACACCTCTGCTGGGACAT 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1096551479 12:52376377-52376399 AATGTTGCCCCAAGTCTGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 119
1096551473_1096551480 22 Left 1096551473 12:52376333-52376355 CCTTCACACCTCTGCTGGGACAT 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1096551480 12:52376378-52376400 ATGTTGCCCCAAGTCTGGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 102
1096551473_1096551478 18 Left 1096551473 12:52376333-52376355 CCTTCACACCTCTGCTGGGACAT 0: 1
1: 0
2: 3
3: 25
4: 232
Right 1096551478 12:52376374-52376396 TTTAATGTTGCCCCAAGTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096551473 Original CRISPR ATGTCCCAGCAGAGGTGTGA AGG (reversed) Intergenic
900106006 1:981396-981418 CTGCCCCAGCTGAGGTGTGATGG - Intronic
902387420 1:16083716-16083738 TTTTCCCAGCAGAGGTATGGAGG + Intergenic
904712840 1:32443948-32443970 ATCTCCAAGCAGATGTGTGGTGG - Intergenic
906406428 1:45546077-45546099 CTGACCCAGCACAGCTGTGAGGG + Intergenic
907108450 1:51905266-51905288 AGATCCCAGCAGAAGTATGAGGG - Intergenic
907432010 1:54417984-54418006 AGGTCCCTGAAGAAGTGTGATGG - Intergenic
907868769 1:58424074-58424096 CTGTCTCAGCAGAGAGGTGAAGG + Intronic
907874498 1:58472606-58472628 ATGTCCCAGCAGAGCTGGGGAGG - Intronic
913346410 1:117815356-117815378 AAGCCCCAGCTGAGGTCTGAGGG + Intergenic
914996393 1:152546541-152546563 AGGTGCCAGCAGAGTTGTAATGG - Intronic
918234205 1:182562566-182562588 AGGTCCCAGCAGAAGAGAGATGG + Intergenic
918987234 1:191647911-191647933 ATGTGCCAGGGGAGATGTGATGG + Intergenic
920784752 1:209030442-209030464 ATGTGCCAGGAGAGGCATGAGGG - Intergenic
920950005 1:210563646-210563668 AACTCTCAGCATAGGTGTGAAGG + Intronic
921345282 1:214177333-214177355 ATGTCCTAGCAGAGGATGGATGG - Intergenic
922588461 1:226753792-226753814 ATGTCTGAGCAGAGATCTGAAGG + Intergenic
923254714 1:232211570-232211592 AAATCCCAGCAGAGGTGTGCTGG + Intergenic
1064181048 10:13116035-13116057 ATATCCCAGCTAAGGCGTGAAGG - Intronic
1065827479 10:29585188-29585210 TGGTCCCAGCTGAGGTGGGAGGG - Intronic
1073468373 10:103707862-103707884 ATTTCCCAGCAGAGGAGGGCAGG - Intronic
1073559073 10:104481621-104481643 TTGTCCCACCAGAGGAGTCAGGG - Intergenic
1075786274 10:125052329-125052351 ATTTCCCAGCAGTGGTCAGAGGG + Intronic
1076817951 10:132923727-132923749 AAGGCCCAGCAGGGGTGTGAGGG + Intronic
1077073497 11:688991-689013 AAGTTCCAGCAGTGGTGTGTGGG - Intronic
1077302567 11:1854058-1854080 AGGTCCCAGAAGAGATGGGAGGG + Intronic
1077493273 11:2871881-2871903 TGAACCCAGCAGAGGTGTGACGG + Intergenic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1081787223 11:45756231-45756253 ATTTCCCAGCTGGGCTGTGAAGG + Intergenic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1083326985 11:61877912-61877934 AGCTCCCAGCAGGGCTGTGATGG + Intronic
1084309387 11:68307976-68307998 ATGAGCCAGCTGGGGTGTGAAGG - Intergenic
1084335493 11:68455355-68455377 CTGTCACTGCAGAGGTGAGAGGG - Intergenic
1084570346 11:69956087-69956109 AGGTCCTGGCAGAGGTGTGGTGG + Intergenic
1087152601 11:94872183-94872205 ATGTCACAGCAGAGGTCTAATGG - Exonic
1088040512 11:105375653-105375675 ATGTCCAAGCAGAGATGTGCTGG - Intergenic
1088107079 11:106219546-106219568 ATATTGCAGCAGAGGAGTGAGGG - Intergenic
1089408154 11:118216022-118216044 ATGTCCTAGCAGAGCTGGGTGGG - Intronic
1090807714 11:130212764-130212786 AGGCCACAGCAGAGGTCTGAAGG + Intergenic
1095122383 12:38434842-38434864 ATTTCCAAGCAGAGAGGTGAAGG - Intergenic
1095727311 12:45468427-45468449 CTGGCCCAGCAGGGCTGTGAAGG - Intergenic
1096220605 12:49826353-49826375 ATGTCTCACCACAGGCGTGATGG + Intronic
1096322263 12:50625477-50625499 AGGTTCCAGCACAGGTGTTAGGG + Intronic
1096551473 12:52376333-52376355 ATGTCCCAGCAGAGGTGTGAAGG - Intergenic
1096793801 12:54061478-54061500 CTGACCCAGCTCAGGTGTGATGG + Intergenic
1097343898 12:58469951-58469973 ATGTGACTGCAGAGATGTGAAGG - Intergenic
1100673442 12:96841000-96841022 ATTTGCCAGCAAAGGTGTCAAGG + Intronic
1101179004 12:102190232-102190254 ATATGCAAGCAGAGCTGTGAGGG - Intronic
1102514902 12:113439867-113439889 GCTTCCCAGCAGAGCTGTGAGGG - Intergenic
1103075761 12:117981281-117981303 CAGTCACAGCAGAGGTGGGAGGG - Intergenic
1103728650 12:123011911-123011933 AAATCCCAGCAGAGGTGGGGGGG + Intronic
1104651684 12:130539393-130539415 ATGTCTGAGCAAAGATGTGAAGG + Intronic
1105022583 12:132827316-132827338 ATGTCACTGCAGAGACGTGAAGG + Intronic
1105308157 13:19183375-19183397 ATGCCCCAGCAGCTGTGTAAAGG - Intronic
1105986355 13:25571108-25571130 ATCTCCCAGCAGAGGTGATTGGG + Intronic
1108530389 13:51322522-51322544 ATGTCCAAGCCGAGGTGGGCAGG + Intergenic
1109954508 13:69548270-69548292 CTGTCACAGCAGGTGTGTGAAGG + Intergenic
1110766151 13:79281476-79281498 ATTTCCCAGCGGGGGTGGGAAGG + Intergenic
1113721843 13:112563302-112563324 ATGGCTCCGCAGAAGTGTGAAGG - Intronic
1113972105 13:114198931-114198953 CGGTCCCCGCTGAGGTGTGATGG + Intergenic
1115692799 14:35862793-35862815 ATGTCCCAGCAAAGGAGAAAAGG + Intronic
1117612871 14:57502600-57502622 ATATCCCACCAGAGGAGTGAGGG + Intergenic
1118370464 14:65133368-65133390 AGGCCCCACCACAGGTGTGAGGG + Intergenic
1119612052 14:76071849-76071871 ATTTCCCAGCTGTGGTGTGCTGG - Intronic
1121105998 14:91280077-91280099 GTGGCCCAGGAGAGGTGTGCAGG - Intronic
1122859045 14:104574057-104574079 ATGTCCCAGCAGCTGTGTGCAGG + Intronic
1124155980 15:27225667-27225689 ATGGCCCAGGAATGGTGTGAGGG + Intronic
1125231519 15:37462281-37462303 ATGTCCAGGCAGAGGTGTGCTGG - Intergenic
1125327603 15:38552818-38552840 ATCTCCTAGCAGTGGTGTGCTGG - Intronic
1125423223 15:39525423-39525445 ATGCCCAAACAGAGGTGGGAAGG + Intergenic
1128062196 15:64742298-64742320 ATGGCACAGCAGGGGTGGGAAGG - Intronic
1128195799 15:65754718-65754740 CTGTCCCAGCAGGTGTGAGATGG - Intronic
1128404951 15:67326572-67326594 CTGTCCCACCAGCGGTGTAAGGG + Intronic
1129840233 15:78739275-78739297 ATGTCGCAGCAGCTGTGGGAGGG + Intergenic
1130857190 15:87850928-87850950 ATGTCTCAGCAGAAGTTTGAGGG + Intergenic
1131024831 15:89131455-89131477 AGGACCCAGCAGAGAGGTGAAGG + Intronic
1131359955 15:91781811-91781833 GTGTCTCAGCAGAGCTGTGCAGG - Intergenic
1133891440 16:9883041-9883063 ATCTCCCAGCTGGTGTGTGATGG - Intronic
1134585622 16:15408017-15408039 TTTTCCCAGCAGAGTGGTGACGG + Exonic
1134908680 16:18004540-18004562 ATATTCCAGCAGAAGTGTGAGGG + Intergenic
1135806373 16:25546431-25546453 AAATCCCAGCTGAGCTGTGAAGG - Intergenic
1136104007 16:28015931-28015953 TTGTTTCAGCAGAGGTGGGAAGG - Intronic
1136319652 16:29475260-29475282 TTTTCCCAGCAGAGCGGTGACGG + Intergenic
1136434223 16:30214604-30214626 TTTTCCCAGCAGAGCGGTGACGG + Intergenic
1138413205 16:56855589-56855611 ATCCCCCAGCAGAGCTGTAAAGG - Intergenic
1138965917 16:62083979-62084001 TTATCCCACCAGAGGAGTGAAGG + Intergenic
1139339655 16:66259676-66259698 CTGTGCCAGCAGAGGCGAGAGGG + Intergenic
1139927162 16:70495842-70495864 ATGTACTAGCAGAGCAGTGATGG + Intronic
1140711837 16:77685939-77685961 ATGGCCCAGCAGTGGTGGGCTGG - Intergenic
1141062874 16:80890874-80890896 ATTTTTCAGCAGAGGTGTGCTGG - Intergenic
1141579299 16:84986361-84986383 ACGTCCCAGCACTGCTGTGACGG + Intronic
1141663366 16:85453472-85453494 GGGTCCCAGCTTAGGTGTGAGGG + Intergenic
1143100911 17:4504218-4504240 AAACCCCAGCTGAGGTGTGAGGG + Intronic
1146715175 17:35079985-35080007 ATGTGCAAGCAGGGGTGGGAAGG - Intronic
1147181678 17:38690460-38690482 ATGTCCCACCCGAGATGTGAGGG - Intergenic
1147454877 17:40530924-40530946 CTGTCCAAGCAGAGGTCTGAAGG + Intergenic
1149204917 17:54232985-54233007 ATAACCAAGCAGAGGTCTGAAGG + Intergenic
1149775286 17:59352324-59352346 AAGTCCCAGTAAAGGTCTGAGGG - Intronic
1152899800 17:82934005-82934027 CTGCCCCAGCAGCGGTGGGAAGG - Intronic
1153859646 18:9188494-9188516 ATGTCCCAACACAGCTGTAATGG + Intronic
1157289209 18:46398143-46398165 GTGGCCATGCAGAGGTGTGAGGG + Intronic
1158630617 18:59111167-59111189 ATCTCACAGCATATGTGTGAGGG + Intergenic
1158830870 18:61277290-61277312 ATGTCATAGCATAGGAGTGAGGG + Intergenic
1160716168 19:577794-577816 CTGTCCCAGCAGAGGTGGGTGGG + Exonic
1161637268 19:5396751-5396773 GTGTCCCAGCAGAGGGGCGAGGG + Intergenic
1162576015 19:11499266-11499288 GTGTCCCAGCAGAACTGTGGGGG - Intronic
1162879014 19:13643726-13643748 ATTGCCCAGCAGAGGAGTGAGGG + Intergenic
1163240876 19:16062853-16062875 TTGTCCCAGCTGAGGGGCGAAGG - Intergenic
1163648493 19:18503651-18503673 ATGTCTGAGCAGTGGTGGGAAGG + Intronic
1166293658 19:41878682-41878704 ATGGCGCTGCAGAGGTGAGAAGG + Intronic
1166662580 19:44657068-44657090 ACATCCCAGCAGAGGCCTGAAGG + Intronic
1167859700 19:52272825-52272847 ATGTCCCAGCAGAGAAGTGAGGG - Intronic
925128984 2:1481279-1481301 CCTTCCCAGCACAGGTGTGAGGG + Intronic
926136961 2:10343193-10343215 GGGTCCCAGGAGAGGGGTGATGG - Intronic
927351623 2:22123739-22123761 ATGTACCAGCAGACAGGTGAAGG - Intergenic
929246628 2:39709609-39709631 AAGCCCCAGCAGAGGTGTAAAGG - Intronic
929948688 2:46389688-46389710 ATCTCCCACCAGAGCTGGGATGG + Intergenic
930618541 2:53620232-53620254 ATGTTGCAGCACAGGTGTGGAGG + Intronic
931718123 2:65045649-65045671 ATCTCCAAGCAGATGTGTGGTGG - Intergenic
932458348 2:71864377-71864399 TTGTCCCAGCATATGTGTGGAGG - Intergenic
934513628 2:94969493-94969515 TTGACCCAGCAGGGATGTGAGGG + Intergenic
934695133 2:96394545-96394567 TTGTCACAGCAGAGATGTGGCGG - Intergenic
935361810 2:102251586-102251608 ATGTTCCCGCAGTGATGTGAAGG - Intergenic
935618968 2:105112405-105112427 GTGTTTGAGCAGAGGTGTGAAGG + Intergenic
936965949 2:118127873-118127895 GCTTCCCAGCAGAGGTGTTACGG + Intergenic
937278801 2:120703448-120703470 ATTTTCCAGCTGAGGCGTGATGG + Intergenic
938921184 2:135996540-135996562 ATTTCCCTGCAGAGGTTTGAGGG - Intergenic
939302390 2:140361571-140361593 ATGTTTCAGCAAAGATGTGATGG - Intronic
939647245 2:144715810-144715832 ATGTTCCAGGAGAAGAGTGAGGG - Intergenic
946328076 2:218994949-218994971 ATATTCCAGCAGAGGTGAGAGGG + Intergenic
947004432 2:225494315-225494337 ATTTCCCTGCAGAGGTATCAAGG - Intronic
947641347 2:231709329-231709351 CCGTCCCGGCGGAGGTGTGACGG + Intronic
948274049 2:236694808-236694830 ATGTCCCCACAGAGGGCTGAGGG - Intergenic
948394195 2:237632433-237632455 CTGTCCCAGCAGGGGCATGAGGG - Intronic
948747280 2:240105908-240105930 AAGTCACAGCTGAAGTGTGAGGG + Intergenic
1170315216 20:15033590-15033612 ATGTACCCCCAGTGGTGTGATGG + Intronic
1170381334 20:15762702-15762724 TAGTCCCAGGAGAGGGGTGAGGG + Intronic
1170587707 20:17747617-17747639 CTGTCCCAGCAGACCTGAGATGG - Intergenic
1171205119 20:23273091-23273113 ATGTCCCTCATGAGGTGTGAGGG - Intergenic
1172273800 20:33669016-33669038 ATATCCCACCACAGTTGTGATGG + Intronic
1173570027 20:44070017-44070039 ATTTCCCAGCAGATGTTAGATGG + Intergenic
1173837645 20:46136323-46136345 ATTTCCCAGACGAGGTGGGAGGG - Intergenic
1174184692 20:48698253-48698275 CTGTCCCTGCACAGGTGAGACGG + Intronic
1174324451 20:49768155-49768177 AGGTCCCAGCACAGGTGTCTCGG - Intergenic
1174525046 20:51163929-51163951 AGATCCCAGCACAGATGTGAAGG + Intergenic
1175925385 20:62468816-62468838 AGGCCCCAGCAGAGCTGGGAGGG + Intronic
1176077919 20:63256988-63257010 ATGGTCCTGCTGAGGTGTGAAGG + Intronic
1178165991 21:29977928-29977950 GTATGCCAGCAGGGGTGTGAGGG - Intergenic
1178373680 21:32049041-32049063 AGGTCCCTGCAGAGGTAGGAGGG - Intergenic
1179007902 21:37530957-37530979 CGGTCCCAGCAGAGTTGTAATGG + Intergenic
1183867450 22:40715022-40715044 ATCTCCCATCAGTGATGTGAAGG - Intergenic
1184085238 22:42258348-42258370 AGGTGCGAGCAGAGGTGTGTGGG - Intronic
1184239914 22:43206607-43206629 ATGTCCCAGCTGAGGGCGGAAGG + Intronic
1184978513 22:48080156-48080178 ATGTTCCAGCAGATGTAAGAGGG + Intergenic
1185241631 22:49750287-49750309 ATGTCCCAGCAGAGGGGTCAGGG - Intergenic
950426680 3:12928143-12928165 ATGCTGCAGCAGAGGTGGGAGGG + Intronic
950427058 3:12930144-12930166 TTTTCCCAGCAGGGGTGTGCAGG + Intronic
952821802 3:37492327-37492349 CTGCCCCACCAGAGGTCTGAGGG - Intronic
952827014 3:37532450-37532472 ATGTCACCCCAGTGGTGTGAAGG + Intronic
953367557 3:42359149-42359171 ATGTCCCAGTACAGGTGGGAAGG + Intergenic
953664477 3:44916170-44916192 ATGACCCACGAGAGGGGTGATGG - Intronic
954881729 3:53840738-53840760 AGATCCCACCAGAGGAGTGAAGG + Intronic
955536581 3:59930095-59930117 TTATCCCAGCCAAGGTGTGAGGG + Intronic
957090473 3:75724906-75724928 TTGTGCCAGAACAGGTGTGATGG - Intronic
957513186 3:81216066-81216088 TTTTCCCAGCATAGGTGGGATGG + Intergenic
957919404 3:86729479-86729501 ATTACCCAGCAGAGGTGCAATGG - Intergenic
958463707 3:94431625-94431647 ATGTCCCTGGAGAGATGTAATGG - Intergenic
958490443 3:94766030-94766052 CTGTTCCAGCAGAGGTGGCAAGG + Intergenic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
959756547 3:109906194-109906216 ATCTCCCATCACAGGTGTGGAGG - Intergenic
962050197 3:131805609-131805631 ATCACCCAGCAGACATGTGAGGG - Intronic
962061118 3:131928821-131928843 ATGTCCCGACAAAGGTGTCAGGG - Intronic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
963878319 3:150501182-150501204 ATGTCCAAGCAGAAGTTTGCTGG - Intergenic
965095200 3:164217091-164217113 ATGTCCCATGCGAGGTGTTAAGG + Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
967799706 3:193642632-193642654 GTGCCCCAGCAGTAGTGTGAAGG + Intronic
968500174 4:946223-946245 ATGACCTAGGAGAGGAGTGACGG - Intronic
969659653 4:8519040-8519062 CCAGCCCAGCAGAGGTGTGATGG + Intergenic
970845448 4:20532578-20532600 ATGCCCCTGGGGAGGTGTGACGG + Intronic
972660553 4:41112035-41112057 TTCTCACAGCAGAGGTGGGATGG + Intronic
973573746 4:52265477-52265499 CTCTCCCAGCATCGGTGTGAGGG - Intergenic
976006539 4:80437030-80437052 ATGTCCCAGCAGAAAAATGAGGG - Intronic
976009895 4:80474496-80474518 AAGTCCCAGCTGGGGTGGGATGG - Intronic
978233598 4:106430564-106430586 ATCTCCAAGCAAAGGTGTGATGG + Intergenic
978346922 4:107780635-107780657 AAGTCCTAGCTGAGGTCTGAGGG + Intergenic
979209342 4:118080262-118080284 ATGTCCAAGTAGAGATGTGCAGG + Intronic
979354854 4:119691285-119691307 AAGCCCCAGCTGAGGTCTGAGGG - Intergenic
981529795 4:145741290-145741312 TTGCCACAGCAGAGGGGTGAGGG + Intronic
982263521 4:153517278-153517300 ATGTCCCAGCAGAGGTCTGGAGG - Intronic
982545394 4:156726155-156726177 GTGTCCCAACCTAGGTGTGAAGG + Intergenic
983232234 4:165140887-165140909 ATCTCCCAGCCCAGGTGTGGTGG + Intronic
983806745 4:172002790-172002812 ATCTCCCAGCTCAGATGTGAAGG - Intronic
986740378 5:10700446-10700468 AGGTCCCAGCAGATGTGAAAAGG - Intronic
986974880 5:13382552-13382574 AGGTGCCAGCAGAGTTGGGATGG - Intergenic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
987248116 5:16070345-16070367 CCGTCCCAGAAGAAGTGTGAGGG - Intronic
987529962 5:19105029-19105051 ATGTGTCAGGGGAGGTGTGACGG + Intergenic
991291114 5:65034891-65034913 ATCTCTCAGGACAGGTGTGAGGG + Intergenic
993561670 5:89417925-89417947 TTGTCCAGGCAGAGGTGTGCTGG + Intergenic
995242442 5:109900427-109900449 ATGTCCCAACTCACGTGTGATGG + Intergenic
995438015 5:112159658-112159680 AACTCCGAGCAGATGTGTGAAGG - Intronic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997595298 5:135103301-135103323 ATCTCCCTGCAGATCTGTGAGGG + Intronic
998565253 5:143210868-143210890 AAGGCCCAGCTGAGGTCTGAAGG + Intronic
999480682 5:151945441-151945463 ATCTCCCAGCAGGAGAGTGATGG + Intergenic
1001632881 5:173189411-173189433 ATTTCTTAGCAGAGGTGTGCTGG + Intergenic
1002099092 5:176848563-176848585 CTGTCTCATCAGGGGTGTGATGG + Intronic
1002959311 6:1898811-1898833 CTGGCCCAGCATAGGTGGGAAGG - Intronic
1004894590 6:20135576-20135598 ATGTCCCAGTAAAGGTAGGATGG + Intronic
1005995600 6:30929320-30929342 TTGTCCCAGGACAGTTGTGAAGG + Intergenic
1008469076 6:51862742-51862764 ATTTTCCAGGAGAGGTGGGAAGG + Intronic
1010165057 6:72905783-72905805 CTGTTCCAGTAGAGGTGTCAGGG + Intronic
1012588514 6:100950835-100950857 ATGTCCCATCCCAGGTGTTAAGG - Intergenic
1013633515 6:112007819-112007841 AGGTCAGAGCAGAGGTGGGAGGG - Intergenic
1016916527 6:149248982-149249004 ATTACACAGCAGAGGAGTGATGG + Intronic
1017042402 6:150317913-150317935 ATCTCCCACCAGAGGTGACAGGG - Intergenic
1017258119 6:152357460-152357482 ATGTCCCACCAGTGATGTGTTGG - Intronic
1021029854 7:15718036-15718058 AAGTCACGGCTGAGGTGTGAAGG + Intergenic
1021067528 7:16195489-16195511 ATTTCCCAGAAGAGCTGGGAAGG + Intronic
1021346499 7:19535607-19535629 GTGTTCCAGCATAGGTGTTATGG + Intergenic
1022390741 7:29942301-29942323 TGATCCCAGCAGCGGTGTGATGG - Intronic
1024588678 7:50862528-50862550 CTCTGCCAGCAGGGGTGTGATGG + Intergenic
1029574173 7:101392154-101392176 ATTTCACTGCAGAGGTGTGACGG + Intronic
1030423224 7:109336116-109336138 ATGTCCAAGTTGAGGTGTGCTGG + Intergenic
1031011241 7:116526508-116526530 ATGTCCCTGCAGAGGGCGGAGGG - Exonic
1033207609 7:139436345-139436367 GTGTGACTGCAGAGGTGTGAAGG - Intergenic
1034483272 7:151340117-151340139 ATGTCCACGCTCAGGTGTGATGG - Intergenic
1034887044 7:154805972-154805994 ATGTCCCAGCAGTGGGGCGGGGG - Intronic
1035265114 7:157685899-157685921 CTGTCCCAGCAGAGGAGGGGTGG + Intronic
1035321247 7:158030631-158030653 GTGACCCAGCAGAGGTGGGAGGG + Intronic
1035349976 7:158238882-158238904 AGGTGAGAGCAGAGGTGTGAAGG + Intronic
1036599786 8:10249690-10249712 ATGGCCCAACAGAGGTCTGCTGG - Intronic
1038697078 8:29816162-29816184 AGGTCACAGCAAAGGTGTGCTGG + Intergenic
1039011777 8:33101597-33101619 ATGTCCCAGCAGAAAGATGATGG + Intergenic
1039828542 8:41194953-41194975 ATGTGCCAGCAGATGGGTGGTGG - Intergenic
1039957034 8:42215603-42215625 TTGTCCCGGCACAGCTGTGAGGG - Intergenic
1040447597 8:47511473-47511495 AGGTGCCAGCAGAGCTGTGGAGG - Intronic
1041527550 8:58824138-58824160 ATGGCCCAGCAGAAGACTGAGGG + Intronic
1042000220 8:64114067-64114089 GTGTCCCAGCAGTGTTGTGCAGG + Intergenic
1042663581 8:71181625-71181647 ATAGCCCACCAGTGGTGTGAGGG - Intergenic
1044690523 8:94872666-94872688 ATAACCCAGCAGAGGAGTAATGG - Intronic
1044774006 8:95668918-95668940 ATGTCCCAGGAGATGTTGGAAGG - Intergenic
1046338091 8:112816137-112816159 ATGTCTCAGCAGATGTGTCTTGG + Intronic
1046353364 8:113046155-113046177 GTATCCCAGCAGAGGTCTGAAGG - Intronic
1049024140 8:139977183-139977205 ATGTGCCAGAACAGGTGTAACGG + Intronic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1052622787 9:30935622-30935644 TTGACCAAGGAGAGGTGTGAGGG + Intergenic
1055555441 9:77468808-77468830 ATGTCCAGCCAGAGGGGTGAGGG - Intronic
1057220462 9:93255051-93255073 ATGTCCCTGCTCAGGTGTGCTGG - Intronic
1059475100 9:114540275-114540297 GGGTCCCAGCAGAGGTCAGACGG + Intergenic
1059658395 9:116377476-116377498 AGGTCCCAGAAGAGGTGAGGTGG + Intronic
1059701865 9:116782807-116782829 ATGTCTAAGCTGAGATGTGAAGG - Intronic
1185683234 X:1906210-1906232 TTATCCTAGCAGAGGGGTGAGGG + Intergenic
1187413357 X:19070343-19070365 ATGTACCAGATGAGATGTGAGGG + Intronic
1188752701 X:33923441-33923463 ATGTGCCAGCAGGGATGGGAAGG + Intergenic
1191996617 X:67102527-67102549 ATGTCTGAACAGAGATGTGAAGG - Intergenic
1192704843 X:73518749-73518771 AATTCCAAGCAGAGCTGTGAGGG - Intergenic
1199380352 X:147165201-147165223 AGGTCTCTGCACAGGTGTGATGG + Intergenic
1201741938 Y:17333397-17333419 ATGCCCCAGCAAAGGAGGGAGGG + Intergenic
1202069255 Y:20973375-20973397 ATGTCTCATGAGAGGTGTTAAGG - Intergenic