ID: 1096551545

View in Genome Browser
Species Human (GRCh38)
Location 12:52376882-52376904
Sequence CCAGTTCATCAGTTCATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 119}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096551545_1096551553 -7 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551553 12:52376898-52376920 GAACTGGGGGAACTGAGGGTGGG 0: 1
1: 0
2: 4
3: 62
4: 381
1096551545_1096551560 22 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551560 12:52376927-52376949 CTGGGGAGCAACAGATGGCAGGG 0: 1
1: 0
2: 2
3: 27
4: 243
1096551545_1096551557 17 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551557 12:52376922-52376944 GAGACCTGGGGAGCAACAGATGG 0: 1
1: 0
2: 0
3: 40
4: 339
1096551545_1096551554 3 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551554 12:52376908-52376930 AACTGAGGGTGGGTGAGACCTGG 0: 1
1: 0
2: 5
3: 37
4: 241
1096551545_1096551559 21 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551559 12:52376926-52376948 CCTGGGGAGCAACAGATGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 237
1096551545_1096551552 -8 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551552 12:52376897-52376919 TGAACTGGGGGAACTGAGGGTGG 0: 1
1: 0
2: 0
3: 31
4: 366
1096551545_1096551555 4 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551555 12:52376909-52376931 ACTGAGGGTGGGTGAGACCTGGG 0: 1
1: 0
2: 2
3: 36
4: 257
1096551545_1096551556 5 Left 1096551545 12:52376882-52376904 CCTATAATGAACTGATGAACTGG 0: 1
1: 0
2: 2
3: 11
4: 119
Right 1096551556 12:52376910-52376932 CTGAGGGTGGGTGAGACCTGGGG 0: 1
1: 0
2: 6
3: 64
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096551545 Original CRISPR CCAGTTCATCAGTTCATTAT AGG (reversed) Intergenic
906043832 1:42811708-42811730 CCAGTTCATCAGTTCCTCCTTGG - Intronic
908353101 1:63305665-63305687 CCCTTTTAACAGTTCATTATAGG + Intergenic
909106706 1:71419103-71419125 CCAGTTCAATAGTGTATTATTGG + Intronic
910424574 1:87107316-87107338 CCAGTTTAACAGTTCAGAATAGG + Exonic
910530924 1:88234653-88234675 GCAGTTCATCAGTGTATTAAAGG - Intergenic
911391910 1:97255911-97255933 CAAGTTCATCATTTCATTTTCGG + Intronic
912189870 1:107325241-107325263 CTAGTTTTTCAGTTCGTTATAGG - Intronic
912811460 1:112798279-112798301 ACAGATCATCAGGGCATTATGGG + Intergenic
1065770428 10:29073110-29073132 TCAGTTCAACACTTCCTTATTGG + Intergenic
1066345583 10:34582240-34582262 CCAGCTCATCATTTCTTTAAGGG - Intronic
1067108720 10:43383441-43383463 GCAGTTCATAATTTCATTATGGG - Intergenic
1068139787 10:52991520-52991542 CTAGTTTATCAGTTGATCATTGG + Intergenic
1068840064 10:61602347-61602369 CCAGTTCATCACTTTATCATGGG + Intergenic
1068855117 10:61789749-61789771 CCATTCCATCAGTACTTTATAGG - Intergenic
1069115594 10:64502099-64502121 CCAGATCATCAATTCATGAAGGG - Intergenic
1075177197 10:120176529-120176551 CCAGTTGATTAGGTCATTGTAGG + Intergenic
1075907840 10:126097722-126097744 CCACTTCATCAGATAATTAAAGG - Intronic
1080025295 11:27607243-27607265 CCCTTTCTTCAGTTCAATATGGG - Intergenic
1081254247 11:40872374-40872396 ACAGTTTATGAGCTCATTATTGG + Intronic
1082613017 11:55325683-55325705 CCTGTTCATGATTTCATTACAGG + Intergenic
1085111151 11:73890145-73890167 GCAGCTCCTCAGTTCCTTATAGG + Intronic
1089210402 11:116796702-116796724 ACAGTTCGGCAGTTCATTAATGG + Intergenic
1089829819 11:121317324-121317346 TCAGTTCATCTTTACATTATAGG - Intergenic
1093405789 12:18802285-18802307 CTAGTTCATCAGTTCATTGGAGG + Intergenic
1093631487 12:21414753-21414775 TCAGTACATCCTTTCATTATTGG - Intronic
1093785832 12:23191066-23191088 CCAGTTCATTAGTTAATTATTGG + Intergenic
1093881640 12:24410544-24410566 CCTTTTCAACAGTTCATTCTTGG - Intergenic
1094235299 12:28157773-28157795 CCAATTCATATTTTCATTATGGG + Intronic
1095512417 12:42966928-42966950 CCAGTTCTCCATTTCATTCTGGG + Intergenic
1096551545 12:52376882-52376904 CCAGTTCATCAGTTCATTATAGG - Intergenic
1097464941 12:59910526-59910548 TCAGTTTATCAGTTCAATAATGG - Intergenic
1101099740 12:101379979-101380001 CCAGCTAATAAGTTCTTTATCGG + Intronic
1102804519 12:115767857-115767879 CCAGTTCACCATCTCTTTATTGG + Intergenic
1103450883 12:121028046-121028068 CCTGTTCATAAGTTCATTCCAGG - Intronic
1107460784 13:40599956-40599978 CCATTTCATCATTTCATACTTGG - Intronic
1107621719 13:42239129-42239151 CCTGTATATCAGGTCATTATGGG - Intronic
1108569998 13:51740310-51740332 CCTTGTCATCAGTTCATTAGAGG + Intronic
1110795553 13:79632921-79632943 CCAGTTCATCAGTTGCCTTTTGG - Intergenic
1111087212 13:83392375-83392397 TCAGTTAATCTCTTCATTATTGG + Intergenic
1118085378 14:62409237-62409259 CCAGTTCATGAGTATATTCTAGG + Intergenic
1118454367 14:65931284-65931306 TCACTTCATCTGTTCATTATTGG + Intergenic
1120418750 14:84255186-84255208 CCACTTCATCATATCATTTTGGG - Intergenic
1120657048 14:87203550-87203572 CCAGTACATCTGTTTATAATGGG + Intergenic
1121877429 14:97466192-97466214 CCAGTTCATCTGTTCTTGTTAGG + Intergenic
1123916123 15:25029320-25029342 CCAGTTCATTTGTTTAATATTGG + Intergenic
1124057473 15:26255326-26255348 CAAGTGCATCAGTTGATTATGGG + Intergenic
1124438314 15:29669282-29669304 CCAGTCCATCAGTTCATGAATGG - Intergenic
1125897120 15:43311798-43311820 CCAGGTCATCTGTTGACTATGGG + Intergenic
1126177680 15:45752896-45752918 CCAGTGTATCATTTCATTGTTGG + Intergenic
1131502000 15:92977236-92977258 CCTGTTGATCACTTCTTTATTGG + Intronic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1137909174 16:52358699-52358721 CCAGTTCCTGAGTTCATAGTAGG + Intergenic
1138272515 16:55705730-55705752 ACTGGTCATCAGTTCATTTTGGG - Exonic
1140269800 16:73455335-73455357 CCAGTTCCTTAGTGCATCATAGG + Intergenic
1149003219 17:51778303-51778325 CCAGTCCATCAGTTGAGTCTGGG - Intronic
1155840500 18:30636871-30636893 CCAGGTCTGCAGTTCATGATAGG - Intergenic
1156081670 18:33343121-33343143 CTCTTTCATCAGATCATTATAGG + Intronic
1156208762 18:34914845-34914867 CCACTTCATTAATTCATTGTAGG + Intergenic
1160277891 18:77455660-77455682 CCAGTTAGTCATTTCATTTTAGG + Intergenic
1163897760 19:20074502-20074524 CCAGTTCATGAATTTATTCTTGG + Intergenic
925686167 2:6476139-6476161 TCAGTACATCAGCTCATCATGGG - Intergenic
929514097 2:42590569-42590591 CCAGTTTCTCAGTCCATTTTGGG - Intronic
930689614 2:54347423-54347445 CCAGTTCATCAAATTTTTATTGG - Intronic
931095318 2:58933464-58933486 CTGGATCATCAGCTCATTATAGG + Intergenic
931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG + Intergenic
934876024 2:97921601-97921623 CCATTACATGAGTTCTTTATTGG - Intronic
940343350 2:152603866-152603888 CTAGTTAATCAGTTTATAATTGG + Intronic
945664505 2:212724117-212724139 CCAGTTCAACAGGTGATTTTGGG - Intergenic
1169716177 20:8621027-8621049 CTAGTTGATGAGTTCTTTATTGG - Intronic
1170810681 20:19671880-19671902 TCAGTTCATCCTCTCATTATTGG - Intronic
1176009402 20:62884619-62884641 CCTGTCCATCAGTTCCTTAGTGG - Intronic
1177088594 21:16738293-16738315 ACAGTTGATCATTTCATCATTGG + Intergenic
1182014861 22:27031300-27031322 ACATTTCATCAGGTCATCATGGG - Intergenic
959602571 3:108204425-108204447 CCAGTACACCAATTCCTTATTGG - Intronic
965649758 3:170921446-170921468 TCAGTTCTGGAGTTCATTATTGG - Intergenic
966299975 3:178467818-178467840 CCATGTCATCATTTCTTTATGGG - Intronic
972937209 4:44151316-44151338 CTAGTGTAACAGTTCATTATTGG + Intergenic
974460643 4:62183411-62183433 CCAGTTCAACAGTTATTTGTTGG + Intergenic
974642318 4:64646888-64646910 CCATATCATCATTTCATTACAGG + Intergenic
974944233 4:68506800-68506822 CCATTTCATTACTTCAATATTGG - Intergenic
974954781 4:68624112-68624134 CCATTTCATTACTTCAATATTGG - Intronic
976290668 4:83414220-83414242 CAAGTTCAACAGTACATTGTAGG + Intronic
977745148 4:100538094-100538116 CCAGTTAATGAGGTCATAATTGG - Intronic
985066702 4:186129357-186129379 ACAGTTCATGAATTCCTTATGGG - Intronic
986944014 5:12992446-12992468 AGTGTTCATCAGTGCATTATTGG + Intergenic
987384371 5:17314879-17314901 CCAATTCATCAGTTGATTGTTGG - Intergenic
987400264 5:17468172-17468194 CCAAATCATCAGTTTATTACAGG - Intergenic
988620888 5:32822225-32822247 CCAGTTCATCAGTGGAATACAGG - Intergenic
989813468 5:45707125-45707147 AAAATTCATCAGTTCAGTATTGG - Intergenic
990955665 5:61335908-61335930 CTTGCTCATCAGTTGATTATAGG + Intronic
991509747 5:67363717-67363739 CCAGTTGATCAGTTTGATATTGG - Intergenic
993536270 5:89090389-89090411 CCAGTTCATAAATTATTTATTGG + Intergenic
995045103 5:107637139-107637161 ACAGTAAATGAGTTCATTATTGG + Intronic
998454312 5:142259458-142259480 CGAGCTCATCAGTTCATGAATGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999328537 5:150657925-150657947 CCAGCTCATCTGTTCCTTCTGGG + Intronic
1000531675 5:162429739-162429761 TCAGTTCATAAATACATTATAGG + Intergenic
1000765250 5:165281352-165281374 CCTGTTCATCTGTTCATGCTTGG - Intergenic
1001601449 5:172931531-172931553 TCAGTTCATCAGTGCTTCATTGG + Intronic
1003523288 6:6876924-6876946 CCAATTCATCATTCCATGATGGG + Intergenic
1003544206 6:7044672-7044694 CCAGTTAAAGACTTCATTATTGG + Intergenic
1005851460 6:29826206-29826228 TCAATTCATCAGTTCATTCCAGG - Intergenic
1010610058 6:77943592-77943614 AAAGTTCATGAGTTCATTTTTGG - Intergenic
1013467627 6:110431057-110431079 CCAGTACATCATTTCCTAATGGG - Intronic
1015003308 6:128247009-128247031 CCAGTTCAGCTTTCCATTATAGG - Intronic
1015697523 6:135998080-135998102 ACATTACATCAGTTAATTATAGG - Intronic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1027784458 7:82563017-82563039 CTATTTCATCAGTTCAATGTGGG + Intergenic
1031676567 7:124618456-124618478 CCAGTTCATGAGTTCATAATAGG - Intergenic
1031699163 7:124901825-124901847 CCACTTCATCAGGTCATTTAAGG - Intronic
1033102924 7:138491667-138491689 CCTGTTCTTCAGTTCTTTTTGGG + Intronic
1033493125 7:141863922-141863944 ACAGTGCTTCAATTCATTATTGG + Intergenic
1033923226 7:146422019-146422041 CCAGTGCATCATTTCCATATGGG + Intronic
1040550098 8:48430973-48430995 CCAGCTCATCAGGGCATTCTTGG - Intergenic
1040802554 8:51359018-51359040 CCACTTATTCAGTTCATTCTTGG - Intronic
1043096833 8:75985905-75985927 CCATTCCATAAGTTCATTAGAGG - Intergenic
1043970107 8:86519109-86519131 TCAATTCAACAGTTCATCATAGG - Intronic
1046973341 8:120247031-120247053 CCTATTCATCAGTTAATTTTAGG - Intronic
1051378308 9:16428043-16428065 CCATTTCAGCAGTTCAGTAATGG - Intronic
1051496958 9:17734105-17734127 CCAGTTCATCACTCCATAACAGG + Intronic
1056899049 9:90581958-90581980 CCCATTCTTCAATTCATTATAGG - Intergenic
1060056985 9:120422692-120422714 CCTCTCCATCAGTTCATTCTGGG + Exonic
1186268774 X:7862153-7862175 CCAATTCCTGTGTTCATTATCGG + Intergenic
1188573199 X:31614239-31614261 CCAATTCAACAATTCAATATTGG - Intronic
1189610987 X:42734706-42734728 CCAGTTCATCAATTTTTTAATGG - Intergenic
1190553945 X:51615005-51615027 CCAGTTAATAAGTTTATTCTTGG - Intergenic
1195760760 X:108243832-108243854 CCAATTCACCAGTTAATTACAGG + Intronic
1197060378 X:122172366-122172388 TCCATTCATCAGTTCATTTTTGG + Intergenic
1197660180 X:129162294-129162316 CCAGATCATCACTTTATCATGGG + Intergenic
1197691378 X:129504278-129504300 CCTGTTAATCTGTTCATCATTGG - Intronic
1198649567 X:138846876-138846898 CCAAGTCATCAGTTCCTTAAAGG + Intronic
1199187605 X:144935107-144935129 TCAGTTCATGAGTTCTTTATAGG + Intergenic
1199243627 X:145576755-145576777 CCAGATCATCAGTTCCCTAGGGG - Intergenic