ID: 1096555545

View in Genome Browser
Species Human (GRCh38)
Location 12:52401309-52401331
Sequence CATTCTCAACACAGGGACGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096555538_1096555545 19 Left 1096555538 12:52401267-52401289 CCTCTCTGAGCTTCCTCCTTACC 0: 1
1: 0
2: 2
3: 57
4: 433
Right 1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1096555541_1096555545 3 Left 1096555541 12:52401283-52401305 CCTTACCTTCTTCAAGGCAACAA 0: 1
1: 1
2: 2
3: 13
4: 206
Right 1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1096555542_1096555545 -2 Left 1096555542 12:52401288-52401310 CCTTCTTCAAGGCAACAAACTCA 0: 1
1: 0
2: 2
3: 8
4: 217
Right 1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG 0: 1
1: 0
2: 0
3: 16
4: 126
1096555540_1096555545 6 Left 1096555540 12:52401280-52401302 CCTCCTTACCTTCTTCAAGGCAA 0: 1
1: 0
2: 7
3: 15
4: 254
Right 1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG 0: 1
1: 0
2: 0
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096555545 Original CRISPR CATTCTCAACACAGGGACGC AGG Exonic
900254782 1:1692498-1692520 CCTTCACAACAAAGGGACGCTGG + Exonic
900263533 1:1745773-1745795 CCTTCACAACAAAGGGACGCTGG + Exonic
900921140 1:5671365-5671387 CCTTCTGAACACAGGGACCATGG - Intergenic
903147037 1:21380869-21380891 CCTTCTCAACACAGGGCTCCTGG + Intergenic
903327355 1:22577054-22577076 CCTTCCCAACACACGGACACAGG - Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904835317 1:33331949-33331971 CAGTCTCAAGGCAGGGACGAAGG + Intronic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
909399574 1:75212010-75212032 CCTTCTCAACACAGTGATCCAGG + Intronic
909400880 1:75229251-75229273 TATTCTCAACACAGGGACTAGGG + Intronic
911732185 1:101302599-101302621 CATTCTGAACACAGGGAATCTGG + Intergenic
919921515 1:202169068-202169090 CATTCTGCCCACAGGGTCGCAGG - Intergenic
1062930117 10:1347300-1347322 CATTCTTGTCCCAGGGACGCCGG - Intronic
1063949812 10:11212004-11212026 CATACTCCACACAGGGTAGCTGG - Intronic
1069020897 10:63487329-63487351 GATTCTCAACACAGGAGGGCTGG + Intergenic
1069802459 10:71090585-71090607 CCTCCTTAACACAGGAACGCTGG + Intergenic
1075666772 10:124236588-124236610 CTTTTTCAACACAGGGTCTCTGG - Intergenic
1075832010 10:125419635-125419657 CCTTCTCAACATGGGGACGAGGG + Intergenic
1082299975 11:50493671-50493693 CATTCTTCACACATAGACGCTGG - Intergenic
1082953526 11:58844285-58844307 CATTCTCAACATTGAGACCCTGG + Intronic
1083993853 11:66262557-66262579 CACTCTGTACACAGGGACACAGG + Intronic
1084415722 11:69031982-69032004 CAGTCTCAAGACAGGGGCCCAGG - Intergenic
1084672348 11:70614811-70614833 CCTTCTCAACACAGGGCTGCAGG + Intronic
1084735413 11:71102436-71102458 CAGCCCCAAAACAGGGACGCGGG + Intronic
1085742725 11:79090805-79090827 CATGCCCAACACAGGGACGTCGG - Intronic
1089767284 11:120777118-120777140 CATTCTAAAAACACCGACGCGGG + Intronic
1096189879 12:49609577-49609599 CAATCTCTACACAGGGAGGGTGG - Intronic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1098772125 12:74565775-74565797 CATCCTGAACACAGGAAAGCAGG - Intergenic
1099361563 12:81707969-81707991 CAATGACAACACATGGACGCAGG + Intronic
1100469832 12:94880551-94880573 CCTTCTCAACACAGGGCTTCAGG - Intergenic
1101790677 12:107924175-107924197 CATTGAGAACACATGGACGCAGG + Intergenic
1102842550 12:116141643-116141665 CACCCTCACCACAGGGACTCTGG + Intronic
1103711713 12:122917736-122917758 CCTTGTCAACACAGGGCCTCGGG + Intergenic
1104222633 12:126799776-126799798 CATGCTCAACACAGAGAATCAGG + Intergenic
1110762932 13:79250741-79250763 CATTCTCAGTAAAGGGAAGCAGG - Intergenic
1110898847 13:80794521-80794543 CATACTGAACACAGTGACGGTGG - Intergenic
1112374142 13:98823401-98823423 CATTCTCATGCCAGGGAGGCAGG - Intronic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1113833136 13:113312635-113312657 AATCCTCAACACAGGGCCCCGGG + Intronic
1115436106 14:33376096-33376118 CATTCTCAAAACAGACACACAGG + Intronic
1120178795 14:81322570-81322592 CATTATCACCACAGGAACACTGG + Intronic
1125362773 15:38881622-38881644 CATTGAGAACACAGGGACACAGG + Intergenic
1126136502 15:45397374-45397396 CATTCTCCAGAGAGGGACGGAGG + Intronic
1128791097 15:70434453-70434475 CATTGTCCACCCAGGGAAGCAGG - Intergenic
1134410258 16:13998061-13998083 CATTCTAGACACAGGGAAACAGG + Intergenic
1137071566 16:35908813-35908835 GATTATCAAGACAGGGACTCTGG - Intergenic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1138890041 16:61130735-61130757 CATTCACAATCCAGGGACACTGG - Intergenic
1142786779 17:2230581-2230603 CATTCTGAAAACAAGGACCCTGG + Intronic
1143134446 17:4703820-4703842 CATCCTCCCCACAGGGCCGCGGG + Intronic
1143312565 17:6004311-6004333 CATGCAGAACACAGGGACACAGG + Intronic
1146397482 17:32480316-32480338 CATTCTCATCACAGGGAAGAGGG - Intronic
1148195412 17:45709480-45709502 GATTCTCAAGACAGTGACCCAGG - Intergenic
1152117148 17:78395412-78395434 CATTGTCAACACAGGAAGACAGG - Intronic
1158175076 18:54646642-54646664 CATGCTCAAAACAGGAACGTGGG - Intergenic
1161086904 19:2339610-2339632 CCAGCTCAACCCAGGGACGCGGG + Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162365380 19:10245580-10245602 CATTCTCAACACAGCCCCGTAGG + Intergenic
1163871093 19:19821824-19821846 CATTATCCAATCAGGGACGCTGG - Intergenic
1163884923 19:19956895-19956917 CATTATCCAGTCAGGGACGCTGG - Intergenic
1163898161 19:20077912-20077934 CATTATCCAATCAGGGACGCTGG + Intergenic
1163939456 19:20478786-20478808 GATTATCAAGACAGGGACCCTGG - Intergenic
1163948892 19:20565851-20565873 CATTATCCAATCAGGGACGCTGG - Intronic
1164070973 19:21767643-21767665 CATTATCCAACCAGGGACGCTGG - Intergenic
1164199266 19:23003243-23003265 CATTATCCAATCAGGGACGCTGG - Intergenic
1164279741 19:23758961-23758983 CATTATCCAGTCAGGGACGCTGG - Intergenic
1165488842 19:36111562-36111584 CATTCCCAACACAGAGAAGTAGG - Intronic
1168013774 19:53555142-53555164 CCATCTCAGCACAGAGACGCTGG - Intronic
1168013796 19:53555294-53555316 CCATCTCAGCACAGAGACGCTGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
929068473 2:38004892-38004914 CAATCAGAACACATGGACGCAGG - Intronic
931107282 2:59070308-59070330 CATTCTCAACACAGTGTTCCAGG + Intergenic
933166902 2:79086631-79086653 CATTCCCAGCACAGAGATGCTGG - Intronic
936505624 2:113103410-113103432 CGTTCTCAAAATAGGGACACAGG + Intergenic
947137168 2:226987053-226987075 CATTCTCAGCACAGTAACACAGG + Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1168932970 20:1638814-1638836 CAATGTGAACACATGGACGCAGG - Intronic
1169645696 20:7807118-7807140 CATTCTCCACAAAGGAACACAGG - Intergenic
1171767847 20:29300194-29300216 CATCCTCAAGACTGGGATGCCGG - Intergenic
1171865979 20:30488011-30488033 CAATCTCACAACTGGGACGCGGG - Intergenic
1172467468 20:35166772-35166794 CATTCTAAACCCAGGGATGGGGG - Intergenic
1175306340 20:57978204-57978226 CATTCTCAACAAACTAACGCAGG - Intergenic
1175451878 20:59076288-59076310 CATTCTTCACACAGTGACACTGG + Intergenic
1176298075 21:5084967-5084989 CCTTCTCAACACCCGGACGTGGG - Intergenic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1179858954 21:44176982-44177004 CCTTCTCAACACCCGGACGTGGG + Intergenic
1182076825 22:27500535-27500557 CATTCTCACCACTGTGAGGCAGG - Intergenic
1183803424 22:40187635-40187657 CCTCCACCACACAGGGACGCTGG - Intronic
1184384250 22:44165341-44165363 CATTCTCAGCACCGGCATGCAGG - Intronic
949924138 3:9027648-9027670 AATTCTCAACACAGGCACCTGGG + Intronic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
952842060 3:37654886-37654908 CAATGACAACACAGGGACACAGG - Intronic
960146579 3:114210233-114210255 CATCCTCATCACAGGGATGGTGG + Intergenic
960236712 3:115291820-115291842 CATTCTTAAAAGAGGGACCCAGG + Intergenic
961332362 3:126150082-126150104 CATTCTAATCACAGGGACATGGG + Intronic
963927315 3:150964776-150964798 CATTCTCAGCAAACTGACGCAGG + Intronic
964701158 3:159569098-159569120 CATTTAAAACACAGGGACTCAGG - Intronic
964967766 3:162518770-162518792 CATTCTCAAAAGAGGGACAGTGG - Intergenic
965950822 3:174305890-174305912 CATTTTCAACACATGAATGCAGG + Intergenic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
979978082 4:127221498-127221520 CATTCAGAACACATGGACACAGG - Intergenic
980889912 4:138803939-138803961 AATCCTCAACAGAGGGATGCGGG + Intergenic
983318559 4:166165318-166165340 CATACAGAACACATGGACGCAGG - Intergenic
986773772 5:10995742-10995764 CATTCTCAAGACAGGAAAGGTGG + Intronic
991288682 5:65009600-65009622 TAATCACAACACAGGGATGCAGG - Intronic
991934272 5:71786331-71786353 CATTCCCAACACATGGCCTCGGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
1008739436 6:54587472-54587494 CATTCTTACCTCAGGGACGGGGG + Intergenic
1011319200 6:86071355-86071377 CATTTTGAACACATGGACACAGG - Intergenic
1011557878 6:88588242-88588264 CATTGTGCACACAGGGACTCGGG - Intergenic
1016604284 6:145901561-145901583 CATTCTCAAGACAGGTAAACTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1020237498 7:6367628-6367650 CATTGTCATCACAGGGGAGCTGG + Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1025776255 7:64563142-64563164 CATTATCCAATCAGGGACGCGGG - Intergenic
1025814999 7:64903180-64903202 CATCCTCCAATCAGGGACGCTGG + Intronic
1025825412 7:65006757-65006779 CATTATCCAATCAGGGACGCTGG - Intergenic
1027944605 7:84728840-84728862 CATTTTGAACACATGGACACAGG + Intergenic
1027946289 7:84749372-84749394 CTTTCACAACACAGGGACTCAGG + Intergenic
1028940415 7:96515823-96515845 CAATGAGAACACAGGGACGCAGG + Intronic
1031376160 7:121028255-121028277 CATTCTCAACACGTGGTCCCAGG - Intronic
1034653526 7:152711382-152711404 CATTCTCACCACATGGCGGCAGG - Intergenic
1044237857 8:89852572-89852594 CATTCTTAAAACAGGGAGGCAGG - Intergenic
1044922886 8:97184731-97184753 CCTTCTCAACACAGGGCCCCAGG + Intergenic
1048293231 8:133196109-133196131 CATCCACATCACAGGGATGCAGG - Intronic
1050123236 9:2330078-2330100 CAATGACAACACAGGGACACAGG - Intergenic
1051617186 9:19017435-19017457 CATTCTACAGACAGGGACACTGG + Intronic
1052048839 9:23823246-23823268 TATTCTCATCCCAGGCACGCGGG + Intronic
1059375801 9:113880455-113880477 CCTTCTCAACACAGTGATCCAGG - Intronic
1059384844 9:113956366-113956388 CTTTCTCAACACATGGTCCCAGG + Intronic
1060618457 9:125040928-125040950 CATTTTTAAAACAGGGAGGCCGG - Intronic
1061067589 9:128288314-128288336 CATTCTCCACACAGAGCTGCTGG - Intronic
1061945016 9:133903740-133903762 AATTCTCAACAGGGGGATGCTGG + Intronic
1062154854 9:135041503-135041525 CATTCTCAGCACAGAGACTATGG - Intergenic
1185669490 X:1794845-1794867 CCCTCTCCACCCAGGGACGCTGG - Intergenic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1190260128 X:48792208-48792230 ATTTCTCACCACAGGGAGGCAGG - Exonic
1197820666 X:130537959-130537981 AATTCCCAACTCAGGGACTCAGG + Intergenic
1199298871 X:146189473-146189495 CCTTCTCAACACATAGATGCTGG - Intergenic