ID: 1096556408

View in Genome Browser
Species Human (GRCh38)
Location 12:52406672-52406694
Sequence TTATACACCCTGGCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096556408 Original CRISPR TTATACACCCTGGCTTCTCT GGG Intergenic
901362946 1:8719424-8719446 TAATACACCCTGGATCCTTTTGG - Intronic
903867235 1:26408797-26408819 TTGAACGCTCTGGCTTCTCTAGG - Intergenic
905397115 1:37674003-37674025 GGTTACACCCTGGGTTCTCTGGG + Intergenic
910725487 1:90333948-90333970 TTACACTCACTGTCTTCTCTGGG + Intergenic
911540516 1:99151974-99151996 TTATCCAGCCTGGCTCATCTGGG + Intergenic
918421937 1:184373089-184373111 TTACTCTCCCTGCCTTCTCTGGG - Intergenic
922873464 1:228921362-228921384 TTTTTCACACTGGCTTCTCATGG - Intergenic
924235331 1:241995414-241995436 TTGTTCACGCTGGCTTCACTGGG + Intergenic
1065748591 10:28864601-28864623 TTAGAAACCCTGGCATATCTGGG - Intronic
1066528222 10:36306028-36306050 TTATGCACCTTGGATTCTGTAGG - Intergenic
1067542509 10:47166160-47166182 TCAAACACCCTGGCTCCTCCAGG - Intergenic
1069679084 10:70270896-70270918 CTATACACCCTGATCTCTCTTGG - Intronic
1073549726 10:104386629-104386651 TTCTACACACTGGCTTCTTGGGG + Intronic
1073815359 10:107200420-107200442 TTATATCCCCTGCATTCTCTGGG - Intergenic
1074491291 10:113941768-113941790 TTAAACCCCCTGGCTTCTGCAGG - Intergenic
1084351354 11:68602229-68602251 TTATTCACCCTGGGTACTATGGG - Intronic
1089029717 11:115312893-115312915 TTATACTCCCAGCCATCTCTTGG - Intronic
1091761893 12:3093075-3093097 TCATACACATTGTCTTCTCTGGG + Intronic
1091781027 12:3214733-3214755 TTAAGCACCCTGGCTACGCTGGG + Intronic
1092612972 12:10190978-10191000 TTTTCCACCATGGCTCCTCTAGG - Exonic
1095678595 12:44948804-44948826 TCACACACCCTTGCTTCCCTGGG + Intergenic
1096556408 12:52406672-52406694 TTATACACCCTGGCTTCTCTGGG + Intergenic
1096603872 12:52751033-52751055 TTCTGCTGCCTGGCTTCTCTGGG - Intergenic
1100023379 12:90098494-90098516 TTACACTCCCTGGTTTCTCTAGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102645574 12:114401440-114401462 TTCTAGACTCTGTCTTCTCTGGG + Intronic
1106160798 13:27199716-27199738 TTTATCACCCTGCCTTCTCTCGG + Intergenic
1107675962 13:42797018-42797040 ATATTCACTCTGGCTCCTCTTGG - Intergenic
1107807501 13:44167943-44167965 TTGAACATCCTTGCTTCTCTGGG + Intergenic
1110147090 13:72204971-72204993 TTATACACCCCAGATTCTCCTGG - Intergenic
1112246880 13:97743368-97743390 TTACAAACCCTAGCCTCTCTAGG - Intergenic
1112720337 13:102236873-102236895 CTCTCCAGCCTGGCTTCTCTGGG - Intronic
1121239649 14:92419674-92419696 TTATATCCTCTGGTTTCTCTAGG - Intronic
1124834101 15:33178811-33178833 CAATACACCCTGCCTTCTATTGG + Intronic
1128807746 15:70545389-70545411 GTAGAGACCCTGGCTACTCTAGG - Intergenic
1130136005 15:81182593-81182615 TTATACACATTTGCTTCTCAAGG + Intronic
1130709441 15:86265294-86265316 TTATAGACCCTGGCTTAGTTAGG + Intronic
1131228455 15:90643872-90643894 TTGTACAGCCTTGCTCCTCTGGG - Intronic
1133170504 16:3979909-3979931 TGACACACCCTGGATTTTCTTGG + Intronic
1138128068 16:54455088-54455110 GTAAACACCCTGGCTTCACGAGG - Intergenic
1139749623 16:69101538-69101560 TCTTCCACCCTGGCCTCTCTTGG + Intergenic
1141365303 16:83437139-83437161 TTATACACCATGGCCTCTCCTGG - Intronic
1143317363 17:6042545-6042567 TTACACCCTCTGGCTTCTCAGGG - Intronic
1146218465 17:30997886-30997908 TTATACAGCATGACTACTCTAGG - Intronic
1148328863 17:46800924-46800946 TGCTACCCCCTGCCTTCTCTTGG - Intronic
1150877999 17:68991368-68991390 TTAGATATCCTGGATTCTCTGGG - Intronic
1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG + Intergenic
1156097473 18:33552246-33552268 TTCTGCACCTTGGCATCTCTTGG + Intergenic
1157298845 18:46465299-46465321 TTTTAAACCCTGCCTTCTGTTGG + Intergenic
1157421480 18:47551059-47551081 CCATACTCCCTGCCTTCTCTGGG - Intergenic
1157475227 18:48019750-48019772 TTGTACACACAGGCTGCTCTGGG - Intergenic
1157708007 18:49824806-49824828 TTAAACATGCCGGCTTCTCTTGG - Exonic
1158883867 18:61806841-61806863 TTAGATACCCTGACTTCTCCAGG - Intergenic
1159085147 18:63781677-63781699 TACTGCACCCTGGGTTCTCTAGG + Intronic
1159240164 18:65732164-65732186 TTATATACCTTGGTTTCTTTAGG - Intergenic
1162688836 19:12412215-12412237 TTACCCAACCAGGCTTCTCTTGG - Intronic
925671388 2:6313097-6313119 TTCTACTCCATGGCTTCTTTGGG + Intergenic
925780265 2:7375415-7375437 TCCTTCATCCTGGCTTCTCTGGG + Intergenic
925961503 2:9021530-9021552 TCAGACACACTGGCTTCCCTGGG - Intergenic
926893373 2:17658189-17658211 TTATTCTTCCTGGCTTCTGTGGG + Intergenic
930109053 2:47662714-47662736 TTTTCTACCCTGTCTTCTCTAGG + Intergenic
931164309 2:59730005-59730027 TCATAAACCCTCGCTTGTCTTGG + Intergenic
932905762 2:75748758-75748780 TTAATCACCCTGGCTTCTTATGG + Intergenic
934682009 2:96290866-96290888 TTAATATCCCTGGCTTCTCTAGG + Intronic
935382258 2:102464817-102464839 TTACAAACCCTGGGTGCTCTTGG + Intergenic
935551359 2:104460744-104460766 TTAATCAGCCTGGCTTTTCTAGG - Intergenic
936437792 2:112522949-112522971 CTTTACACACTGGCTGCTCTGGG - Intronic
936531913 2:113282458-113282480 CTATGTACCCTGGTTTCTCTGGG + Intergenic
937856563 2:126676058-126676080 CCACACAACCTGGCTTCTCTAGG + Intronic
938743937 2:134259505-134259527 TTGTTAACCCTGGCTTCTCTGGG + Intronic
939204987 2:139090147-139090169 TTTTAGACCTTGGCTACTCTGGG + Intergenic
940379884 2:153001962-153001984 TCAAACATCCTTGCTTCTCTGGG - Intergenic
940673886 2:156705112-156705134 TTTTAGACCCTGGATGCTCTGGG + Intergenic
944098095 2:195992866-195992888 TTCTACATCCTGGCTTTCCTTGG + Intronic
945179640 2:207078676-207078698 TTAGACACCCTGAATTCTGTTGG - Exonic
948188220 2:236038135-236038157 CCATACACCCTGGCTTTACTGGG + Intronic
1175358867 20:58391231-58391253 TGATATAACTTGGCTTCTCTGGG - Intronic
1175530549 20:59671890-59671912 GTATCCAGCCTGGCCTCTCTAGG + Intronic
1177199725 21:17940719-17940741 AGATACACCCTGATTTCTCTTGG - Intronic
1184795332 22:46728844-46728866 CAGCACACCCTGGCTTCTCTGGG - Intronic
949622094 3:5824887-5824909 TTATACATCCTGTCTTATTTTGG + Intergenic
949923851 3:9025206-9025228 ATATTCACCCTGGCTTCCCCTGG + Intronic
951755277 3:26084564-26084586 TTATACAACTTGGCTTAGCTGGG - Intergenic
953563826 3:44014360-44014382 TAATGAACCCAGGCTTCTCTTGG - Intergenic
954866086 3:53731282-53731304 ATATAGACCCTGGCTTCCCAGGG + Intronic
955075404 3:55608654-55608676 TTAAACACCCTTGCTTCATTTGG + Intronic
963317194 3:143772156-143772178 TTCTACACCCTTGCTTGTCCTGG - Intronic
965284968 3:166806878-166806900 TTATACACCCAGGTTTTTTTAGG - Intergenic
967080821 3:186048026-186048048 TCATAAACCATGGCTACTCTTGG - Exonic
969355621 4:6623689-6623711 TTCTACAGCCTGGCTGCGCTGGG - Intergenic
970698443 4:18706015-18706037 TTATACACCCAGGCTTTTTTGGG + Intergenic
974464399 4:62235749-62235771 TTATACATACAGGCTTTTCTGGG + Intergenic
978630408 4:110737766-110737788 TTATACAGGCTGACTTCTGTGGG - Intergenic
979276830 4:118823723-118823745 TCATACATCTTGGCTTCTCCAGG + Intronic
979983402 4:127285067-127285089 TAATAAACTCTGGCTTCTGTTGG - Intergenic
985347446 4:189021594-189021616 TTATACACTGTGGCTTCCCTGGG - Intergenic
987090144 5:14503144-14503166 TCAGACAGCCCGGCTTCTCTTGG + Intronic
989311751 5:40026863-40026885 TTATCCACCAAAGCTTCTCTAGG + Intergenic
996097917 5:119418754-119418776 TTTTACTCCCTGGCTTTTCAAGG + Intergenic
997263477 5:132481122-132481144 TGATGCAAGCTGGCTTCTCTTGG + Intergenic
1001246591 5:170109511-170109533 TTATCCAACCTTGTTTCTCTTGG - Intronic
1004848313 6:19670117-19670139 TGATTCAGTCTGGCTTCTCTAGG - Intergenic
1007010750 6:38415274-38415296 TTATTTACCCTGGATTATCTGGG + Intronic
1009506890 6:64494755-64494777 TTATATTCTTTGGCTTCTCTGGG + Intronic
1013090857 6:106899741-106899763 TTGTACACCAGGGCTTCTCCAGG - Intergenic
1015616311 6:135078968-135078990 TTATACAGATTGACTTCTCTTGG - Intronic
1019936660 7:4262577-4262599 TTAGACACCCTGGCTTATTCAGG + Intronic
1019998787 7:4742754-4742776 AACTACACACTGGCTTCTCTTGG + Intronic
1021935375 7:25625623-25625645 TTAGGCACACTGGCTCCTCTGGG - Intergenic
1023335294 7:39162867-39162889 TTATAGAGCCTGGGTTTTCTAGG + Intronic
1027763393 7:82308142-82308164 GTATCCACACTGGCTCCTCTTGG + Intronic
1028979071 7:96946739-96946761 TTGTACAACCTGGGTTCACTAGG + Intergenic
1030158323 7:106480517-106480539 TTTAACATCCTGGCTTCTCAGGG + Intergenic
1030996458 7:116364876-116364898 TTATACACAATGTATTCTCTGGG + Intronic
1031141434 7:117947652-117947674 TTATACACTCTGGTCTCGCTTGG - Intergenic
1033044284 7:137947359-137947381 ACCTACACCCTCGCTTCTCTGGG + Intronic
1036584023 8:10106501-10106523 TTACAAACCCTGTTTTCTCTAGG + Intronic
1042314235 8:67408734-67408756 TTCTACACCATGACTTCTCCAGG + Intergenic
1042808992 8:72803546-72803568 TTATACACCAGGACTTCTTTGGG - Intronic
1046792898 8:118340849-118340871 TTTTACATCCTGGCTCCTATAGG - Intronic
1048370433 8:133771991-133772013 TTAGAGACCCTCTCTTCTCTGGG - Intergenic
1051890192 9:21933476-21933498 TTTTCCACCCTGTCTCCTCTAGG + Intronic
1053611818 9:39721542-39721564 TGATACAGCCAGGTTTCTCTGGG - Intergenic
1053869858 9:42479541-42479563 TGATACAGCCAGGTTTCTCTGGG - Intergenic
1054086437 9:60749613-60749635 TGATACAGCCAGGTTTCTCTGGG + Intergenic
1054241703 9:62620851-62620873 TGATACAGCCAGGTTTCTCTGGG + Intergenic
1054555829 9:66655374-66655396 TGATACAGCCAGGTTTCTCTGGG + Intergenic
1055809599 9:80136955-80136977 TGCAACACCCTGGATTCTCTAGG - Intergenic
1055983900 9:82036200-82036222 TTAGACACCCTGGGTATTCTGGG - Intergenic
1057032563 9:91787197-91787219 TTTTAAACCCTGGATTCTGTGGG - Intronic
1057604852 9:96491961-96491983 CTGTCCTCCCTGGCTTCTCTGGG - Intronic
1059331939 9:113541205-113541227 TCACACACCCTGGCATCTCCAGG - Intronic
1060001943 9:119966816-119966838 CTTTACACTCTGGCTTGTCTGGG - Intergenic
1187004970 X:15223824-15223846 TGATACAGGCTGGCATCTCTTGG + Intergenic
1187514940 X:19960467-19960489 TTTTTGACCCTAGCTTCTCTTGG - Intronic
1192787823 X:74352379-74352401 TTATAGACTCTGGCTTGGCTGGG - Intergenic
1197713379 X:129688167-129688189 TTAAGCCCCCTGTCTTCTCTAGG - Intergenic