ID: 1096558180

View in Genome Browser
Species Human (GRCh38)
Location 12:52416985-52417007
Sequence TGATTGAAATGCAACACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096558177_1096558180 7 Left 1096558177 12:52416955-52416977 CCAGCATCAGCATCAGCATCACT No data
Right 1096558180 12:52416985-52417007 TGATTGAAATGCAACACTGTGGG No data
1096558176_1096558180 14 Left 1096558176 12:52416948-52416970 CCTCAAACCAGCATCAGCATCAG No data
Right 1096558180 12:52416985-52417007 TGATTGAAATGCAACACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096558180 Original CRISPR TGATTGAAATGCAACACTGT GGG Intergenic
No off target data available for this crispr