ID: 1096559746

View in Genome Browser
Species Human (GRCh38)
Location 12:52427231-52427253
Sequence GGGCTGAGCTTATTGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096559739_1096559746 29 Left 1096559739 12:52427179-52427201 CCTATAATAAGATTTGTCTCTCA 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1096559746 12:52427231-52427253 GGGCTGAGCTTATTGTATATAGG 0: 1
1: 0
2: 2
3: 3
4: 57
1096559742_1096559746 -2 Left 1096559742 12:52427210-52427232 CCATTGTCATGCACTGAGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1096559746 12:52427231-52427253 GGGCTGAGCTTATTGTATATAGG 0: 1
1: 0
2: 2
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096559746 Original CRISPR GGGCTGAGCTTATTGTATAT AGG Intronic
901292338 1:8133823-8133845 GGGCTGAGCTTCTTGGAAAGGGG - Intergenic
906523276 1:46479576-46479598 GGGCTGAGGATTTTGGATATTGG + Intergenic
910303077 1:85729394-85729416 TGGCTGAGCCTATTTTAAATGGG + Exonic
912012843 1:104991418-104991440 GGCTTGAGCTTATTATATTTAGG + Intergenic
919117281 1:193296259-193296281 GAGCTGAGCTCAGTTTATATTGG + Intergenic
921613271 1:217236945-217236967 AGTCTGAGGTTATGGTATATGGG - Intergenic
924189239 1:241532241-241532263 GAGCTGAGCTGATTGTACTTTGG + Exonic
1076024217 10:127099313-127099335 GTGAGGAGCTTATTGTCTATGGG + Intronic
1076062356 10:127423312-127423334 GAGCTGAGCTTATTATATATCGG - Intronic
1079632870 11:22699014-22699036 GGCTTGAGCTTATTTTATTTGGG - Intronic
1079657017 11:22997009-22997031 TGGATGAGCTTTTTGTATAAGGG + Intergenic
1080021661 11:27566923-27566945 GGACTGAGATTATTCTATGTGGG + Intergenic
1087921303 11:103869809-103869831 GGGCTGAGCTCCTTGACTATGGG - Intergenic
1096559746 12:52427231-52427253 GGGCTGAGCTTATTGTATATAGG + Intronic
1101064487 12:101005223-101005245 GAGCTTAGCTTATTCTAAATTGG + Intronic
1102162710 12:110782454-110782476 GGGCTGATTTTATTTTATACAGG + Intergenic
1102331104 12:112031719-112031741 GGCCAGAGCTTATGGTATACGGG - Intronic
1103803387 12:123554153-123554175 GGGCTGGCCTCATTGTTTATGGG + Intergenic
1106666341 13:31854673-31854695 GGTAGGAGCTTAATGTATATTGG + Intergenic
1107810648 13:44196883-44196905 GGGCTGATGTTATTGGAGATGGG - Intergenic
1118149155 14:63170280-63170302 GGTATGGGCTTATTATATATGGG - Intergenic
1125298773 15:38232111-38232133 GGGGTGGGATTTTTGTATATAGG + Intergenic
1143309320 17:5975473-5975495 GGCCTGAGCTCATTGGAGATGGG + Intronic
1157569307 18:48701860-48701882 GGGCTGATCTTATTATATCCAGG - Intronic
1158860480 18:61587191-61587213 GTGCTGAGCTTATTTTCTAGTGG - Intergenic
1164490670 19:28710895-28710917 GGGCTGCACTATTTGTATATTGG + Intergenic
1167464587 19:49643762-49643784 GGGCTGAGCTTATTGAGTATTGG + Intronic
926546054 2:14241564-14241586 GACCTGAGCTTAATGTATCTTGG - Intergenic
932492682 2:72131988-72132010 GGGCTGAGCTGATGGTAAATGGG + Exonic
933536117 2:83577145-83577167 GGGTTTACCTTAGTGTATATGGG - Intergenic
938887500 2:135667126-135667148 AGGCTGATTTTATTTTATATAGG - Intronic
943048576 2:182888663-182888685 GGGATGAGCTTAATGTTAATGGG + Intergenic
1170290300 20:14761843-14761865 GTGCTCAGCCTATTGCATATTGG + Intronic
1174199198 20:48795168-48795190 GGGCTGAGCTGAGTGTTTAGTGG - Intronic
949977573 3:9475087-9475109 GTGCTGAGCTTAATGTCTCTGGG - Exonic
951805063 3:26634793-26634815 GGGCTGAGCTTGGTGGATGTTGG + Intronic
960040764 3:113148159-113148181 GGGCTGTGCTTACTGTACATTGG - Intergenic
963417251 3:145013503-145013525 GGGCTTAGCTTCTTGTAGAGAGG - Intergenic
966334236 3:178850619-178850641 GGGCTGATGTTTTTGTAAATGGG - Intergenic
972325389 4:38010663-38010685 GGGCTGAGGATATTGAAGATGGG - Intronic
973718210 4:53698877-53698899 GGAATGAGCTCATGGTATATAGG - Intronic
980320330 4:131264944-131264966 GTTCTGAGGTTAATGTATATTGG + Intergenic
991638556 5:68731126-68731148 GGACTCAGCATATTGTTTATGGG - Intergenic
992927275 5:81601691-81601713 GGGGTGAGTATATTTTATATTGG - Intronic
993631358 5:90289708-90289730 GGGAAGTTCTTATTGTATATAGG + Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
998061667 5:139123567-139123589 GGGCTGATCCTAGTGTATGTAGG - Intronic
998590204 5:143470213-143470235 GGGCTCAGCTCCTTGTATGTGGG + Intergenic
1001352015 5:170977831-170977853 GGGCTGGGGTTATTGGAGATTGG + Intronic
1004561276 6:16753556-16753578 GGGATGACCTTTTTGTATGTTGG - Intronic
1020813624 7:12876623-12876645 GGCCTAAGCTTATTGTATTCTGG - Intergenic
1024216773 7:47254980-47255002 CGGCTCAGCATATTGTCTATGGG - Intergenic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1033046712 7:137968745-137968767 GGCCTGAGCTGATGGTATACTGG - Intronic
1033808920 7:144986841-144986863 GGGCAGATCTTATTATGTATAGG + Intergenic
1037525908 8:19724083-19724105 GTGCTCAGCTTATTGGATATTGG - Intronic
1040671662 8:49698507-49698529 TGCCTGAGCTTTTTGTATGTGGG - Intergenic
1042607169 8:70557079-70557101 AGCCTGAGCTTACTGTATAAAGG + Intergenic
1047802758 8:128326983-128327005 GGGCTGAGCTTCTTGTCTGCTGG + Intergenic
1048282029 8:133112719-133112741 GGGCTGGGGCTATTTTATATAGG - Intronic
1051431819 9:16987305-16987327 GGGCAGAGCTTAAAATATATGGG + Intergenic
1188593874 X:31872767-31872789 TGGCTAAGGTTATTGTGTATTGG + Intronic
1197009326 X:121541841-121541863 GACCTGAGCTTATTGTATTGTGG + Intergenic