ID: 1096559924

View in Genome Browser
Species Human (GRCh38)
Location 12:52428814-52428836
Sequence CCACCCTGGGTGCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096559914_1096559924 27 Left 1096559914 12:52428764-52428786 CCAGTCACTGAGTCAAATGCCTG 0: 1
1: 0
2: 2
3: 14
4: 231
Right 1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 26
4: 227
1096559917_1096559924 8 Left 1096559917 12:52428783-52428805 CCTGGCCCAGGCACTCGCTGTGC 0: 1
1: 0
2: 2
3: 49
4: 342
Right 1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 26
4: 227
1096559918_1096559924 3 Left 1096559918 12:52428788-52428810 CCCAGGCACTCGCTGTGCACACA 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 26
4: 227
1096559913_1096559924 28 Left 1096559913 12:52428763-52428785 CCCAGTCACTGAGTCAAATGCCT 0: 1
1: 0
2: 0
3: 17
4: 158
Right 1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 26
4: 227
1096559919_1096559924 2 Left 1096559919 12:52428789-52428811 CCAGGCACTCGCTGTGCACACAG 0: 1
1: 0
2: 4
3: 28
4: 254
Right 1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 26
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096559924 Original CRISPR CCACCCTGGGTGCCACAAGC AGG Intronic
900474026 1:2868015-2868037 ACACCCTGGGTGCCTCAAGGGGG + Intergenic
901058576 1:6461041-6461063 CCACCATGGGTGCCAGATCCCGG + Intronic
902618935 1:17639359-17639381 CCACCCTGGAGGCCAAAACCTGG - Intronic
903037863 1:20506103-20506125 CCAGCCTGGGTGACAAGAGCAGG - Intronic
905043057 1:34976403-34976425 CCACCCTGGATGCCACTGGGAGG + Intergenic
906522716 1:46476935-46476957 CCACCCTCAGTGCCCCCAGCAGG + Intergenic
910773172 1:90850706-90850728 CCACCCCCGGTGCCCAAAGCCGG - Intergenic
912691132 1:111805350-111805372 ACAACCTGGATGCCACAACCTGG + Intronic
914753641 1:150551273-150551295 CCACTCTGGGTGCCAGCATCTGG - Intronic
914885439 1:151580805-151580827 CCACCATGCGTGCCACCACCTGG - Intronic
915430157 1:155860148-155860170 CCGCCCTGTGTGCCCCAAGGGGG - Intronic
916166187 1:161969221-161969243 CCACCCAGGGTGGCAGCAGCAGG - Intergenic
918046066 1:180941691-180941713 CCACTCTGGAAGCCACATGCAGG - Intronic
918495280 1:185128082-185128104 CCAGCCTGGGTGACAAGAGCGGG + Intronic
919568439 1:199218375-199218397 CTTCTCTGTGTGCCACAAGCAGG + Intergenic
919735061 1:200943589-200943611 CCAGCCTGGGTGCCAAGAGCTGG - Intergenic
919745725 1:201008200-201008222 CCTCCCTGGCTGCCACAGTCTGG + Intronic
920292953 1:204936719-204936741 CCACTCTGGCTGCCACATGGAGG - Intronic
920299139 1:204977759-204977781 ACACCCTGGGTGCCAAGAGAGGG - Intronic
920599776 1:207312426-207312448 CCAGTCTGGGTGGCACCAGCTGG - Intergenic
921848664 1:219910251-219910273 CCAGCCTGGGTGACAGAAGAAGG + Intronic
922905954 1:229173925-229173947 CCACACTGGGAGCAACAAGTGGG + Intergenic
923064004 1:230501419-230501441 CCAGCCTGGGTGCCAGATGTGGG + Intergenic
923117864 1:230960741-230960763 CCAGCCTGGCTGCCTCAAGAGGG - Intronic
923765829 1:236891513-236891535 CCACCATGGGTGTCAGAGGCAGG + Intronic
1064691158 10:17919913-17919935 CCAACCTGGGTGGCACTAGCTGG - Intergenic
1065448202 10:25824565-25824587 TCACCCTGGGTGTCACGAGCAGG + Intergenic
1067526593 10:47043033-47043055 CCACCCAGGGTGCCACACGCAGG + Intergenic
1070492261 10:76988496-76988518 CCAGCCTGGGTGACAGAAGGAGG + Intronic
1071281343 10:84106844-84106866 CCACCCTCTGTGCCACATGAGGG - Intergenic
1072745731 10:97937910-97937932 CCTCCCTGGGTGTTACCAGCTGG - Intronic
1074157523 10:110811840-110811862 TAACCCTGGGTGCCATTAGCCGG - Intronic
1076560155 10:131357508-131357530 CGATCCTGTGTGCCACAAGGGGG + Intergenic
1081622049 11:44624410-44624432 TCACCCTGGAAGCCCCAAGCTGG - Intergenic
1082679243 11:56148343-56148365 CCAGCCTGGGCGACACAGGCTGG - Intergenic
1083301633 11:61742661-61742683 CAACCCTGGGTGCCACTCCCAGG - Intronic
1083609023 11:63996386-63996408 CCACCCTGGGTCCCTGAAACAGG - Intronic
1084935148 11:72583023-72583045 CTACCCTGGGTCACAAAAGCTGG - Intronic
1084981236 11:72829893-72829915 CTACCCTGAGTGCCTGAAGCAGG - Intronic
1087743482 11:101915422-101915444 CTACCCTGGCAGCCACAGGCTGG - Intronic
1088817505 11:113431896-113431918 CCACCCAGGCTGCCCCAGGCAGG + Intronic
1089270125 11:117296305-117296327 CCACCCAGGGTGCCACCAGTTGG - Intronic
1089816564 11:121182135-121182157 CCACCCAGGGGCCCAAAAGCTGG - Intronic
1090496694 11:127219835-127219857 ACACCATGTGTGCCACATGCAGG - Intergenic
1090673354 11:128966908-128966930 ACACCCTGGGTGCTACATACAGG - Exonic
1092395897 12:8126232-8126254 CCAGCCTGGGTGACAGAACCAGG - Intronic
1093323537 12:17744004-17744026 CCACCCTGGGAGGCAGAGGCGGG + Intergenic
1096400410 12:51301536-51301558 CCAGCCTGGGTGACAGAGGCTGG - Intronic
1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG + Intronic
1097664202 12:62461511-62461533 CCACACTGGGAGCCGCTAGCCGG - Intergenic
1098902956 12:76131866-76131888 CCTCCCTGGGTTCCACAACCTGG + Intergenic
1100345206 12:93723391-93723413 CCAGTCTGGGTGGCACCAGCTGG - Intronic
1100612171 12:96200525-96200547 CCAGCCTGGGTGACAGAACCAGG - Intronic
1102862599 12:116349708-116349730 CCAGCCTGGGTGACAAAATCAGG - Intergenic
1103601502 12:122057476-122057498 CCATCCTGTTGGCCACAAGCAGG + Intronic
1104439330 12:128782082-128782104 CCACCCTGGGTGCCTGGGGCCGG - Intergenic
1104881254 12:132072154-132072176 CCACCCTGGGCAACACAAGCAGG - Intronic
1105750570 13:23419261-23419283 AGTCCCTGGGTGCCACTAGCTGG - Intronic
1110665097 13:78107400-78107422 CAACTGTGGGTGCCAGAAGCAGG - Intergenic
1112019384 13:95358544-95358566 CCACACTGGGTCCCACCAGTGGG + Intergenic
1112479877 13:99765571-99765593 CCAGCCTGGGTGACACAGGGAGG - Intronic
1113542100 13:111116380-111116402 CCAGCCTGGGAACCACCAGCCGG - Intronic
1114229959 14:20772289-20772311 CCAGCCTGGGTGACAGAACCAGG + Intergenic
1115642712 14:35344904-35344926 CCAGCCTGGGTGACAAAGGCAGG + Intergenic
1116116683 14:40661441-40661463 CCACCCTGCCTGCAAGAAGCAGG - Intergenic
1117033260 14:51698074-51698096 CCACCCAGGGAGCCACAATCAGG - Intronic
1118835796 14:69477039-69477061 CCAGCCTGGGTGACACCAGAGGG - Intergenic
1120456702 14:84739702-84739724 CCAGCCTGGGTGACAGAATCAGG + Intergenic
1121436725 14:93925535-93925557 CCACCCTGACTGGTACAAGCAGG - Intronic
1122037636 14:98960379-98960401 CCAGCCTGGCTGCCAGGAGCTGG + Intergenic
1123767133 15:23492670-23492692 CCACCATCGGTGCCACATGAGGG - Intergenic
1125066277 15:35489095-35489117 CAATACTGGGTGCCCCAAGCTGG + Intronic
1125487099 15:40119016-40119038 CCAGCCTGGGTGACAGAAGGAGG + Intergenic
1125563955 15:40660931-40660953 CCAGCCTGGGTGACAGAACCAGG + Intronic
1127823731 15:62684297-62684319 CCTTCCTGGGTCCCAGAAGCTGG + Intronic
1129313579 15:74728125-74728147 CCACTCTGGGTGCCACAGGATGG - Intergenic
1130160506 15:81394490-81394512 CCACCCAGGGGTCCAGAAGCAGG - Intergenic
1131083175 15:89554127-89554149 CCACCCTGGCTGCCACACTCTGG + Intergenic
1131835489 15:96386490-96386512 CCAGCCTGGGTGACACAGGGAGG - Intergenic
1131878080 15:96832337-96832359 CCAGCCTGGGTGACAGAAGAGGG + Intergenic
1131900638 15:97084104-97084126 CCACCCTGGGGGCCTCAGGTGGG + Intergenic
1132880544 16:2160018-2160040 CCTCCCTAGCTCCCACAAGCTGG - Intronic
1133636397 16:7670059-7670081 CCACCCTGGGTGATACAGGGAGG - Intronic
1134267277 16:12702980-12703002 CCAGCCTGGGTGACAAGAGCGGG + Intronic
1139653738 16:68375312-68375334 CCACCCTGGGCTCCACCAGCAGG + Intronic
1139756131 16:69145110-69145132 CCAGCCTGGGCGACAAAAGCAGG + Intronic
1140466553 16:75187698-75187720 CCATTCTGGGTGGCACTAGCTGG + Intergenic
1140516981 16:75550331-75550353 CCACTGTGGATGCCACAAACAGG - Intronic
1142142993 16:88480794-88480816 CCACCCTGGGGCCCACAGTCTGG + Intronic
1147573026 17:41583035-41583057 CCACCCTCTGTACCCCAAGCAGG - Intronic
1148117172 17:45182959-45182981 CCCCCATGTGTGCCACCAGCAGG - Intergenic
1148350424 17:46937895-46937917 CCAGCCTGGGTGGCAGAAGGAGG - Intronic
1152031447 17:77845916-77845938 CCACCCAGGGGGCCACCTGCGGG - Intergenic
1152519228 17:80845621-80845643 CCACCCTCCGTGCCCCCAGCTGG + Intronic
1152564231 17:81093033-81093055 CCACCCTGGGTTCCAGATGCAGG - Intronic
1152741124 17:82018910-82018932 CCACCCGGGGTCCTACAGGCAGG - Exonic
1155492263 18:26410731-26410753 CCAGCCTGGGTGACAGAAGAAGG + Intergenic
1156465961 18:37347981-37348003 CCACCCTGAGAAACACAAGCAGG + Intronic
1156804153 18:41156304-41156326 CCACCGTATGTGCCACAAGAGGG - Intergenic
1157552506 18:48591261-48591283 CCAGCCTGGGACCCACAAGGTGG - Intronic
1157802246 18:50630216-50630238 CCAGCCTGGGTGACACAGACAGG - Intronic
1157991616 18:52503749-52503771 CCAACCTGGGTGAAACAAGAGGG - Intronic
1159943955 18:74429868-74429890 CCAGCCTGGGTGACACAATGAGG - Intergenic
1160940933 19:1620161-1620183 CCACCCTGGCTGACCCACGCTGG + Intronic
1162073596 19:8169851-8169873 CCAGCCTGGGTGACACAGCCTGG - Intronic
1162335784 19:10059448-10059470 CCACCCTGGGTGACAGAGGGAGG + Intergenic
1162854217 19:13455838-13455860 CCAGCCTGGGTGACAGAAGGAGG + Intronic
1164682514 19:30145128-30145150 CCACCCTGGCTGGCAAGAGCAGG + Intergenic
1166099183 19:40560868-40560890 CCACCCTGGGAGTCACATGCTGG + Intronic
1166195954 19:41206110-41206132 CAGCCCTGGGTATCACAAGCAGG + Intronic
925353894 2:3223706-3223728 CCACCCTGGGGGCCACCTACAGG - Intronic
925369459 2:3333921-3333943 CCACACTGGCTGCCCCACGCAGG + Intronic
926036287 2:9638376-9638398 CCATCCTGGATTCCCCAAGCAGG + Intergenic
926697977 2:15784060-15784082 CCACTCTGGGAGCCACAACAGGG - Intergenic
926878469 2:17513122-17513144 ACACCCTTGGTACCACAAGGTGG + Intronic
927901522 2:26822838-26822860 CCAGCCTGGGTGACAGAAGCAGG - Intergenic
928091758 2:28378850-28378872 ACACCCTGGGGGCTAGAAGCTGG + Intergenic
928536512 2:32246597-32246619 CCAGCCTGGTTGCCCCGAGCAGG - Intronic
929543026 2:42836825-42836847 CCAGCCTGGGTGACAGAAGGAGG + Intergenic
930021334 2:47003842-47003864 CCACCCTGGGTGGCCAGAGCTGG + Intronic
932814723 2:74852561-74852583 CCACCCTCCATCCCACAAGCTGG - Intronic
938773472 2:134521026-134521048 CCAGCCTGGGTGACAGAAGGAGG - Intronic
941193188 2:162413157-162413179 CCACCCTGGGGGACAAGAGCAGG - Intronic
945974981 2:216263395-216263417 CCAGCCTGGGTGCCAAAATCAGG + Intronic
946432628 2:219633725-219633747 CCACACTGGGAGCCACCAGCTGG - Intronic
947172621 2:227325928-227325950 CCACCCGCGATGCCACAACCTGG - Intronic
947365933 2:229394937-229394959 CCACCCTCGATGCCACATGAGGG + Intronic
948217273 2:236240965-236240987 CCTCCCTGGCTGCCAGATGCAGG + Intronic
948802405 2:240438848-240438870 CAGGCCTGGGTGCCACCAGCTGG + Intronic
1169159523 20:3364971-3364993 CCAGCCTGGGTGACAGAAGGAGG - Intronic
1174883620 20:54307521-54307543 TCACCCTGGGTGCTGCAGGCAGG - Intergenic
1175253184 20:57622054-57622076 CCCCCTTGGCTGCCAAAAGCTGG - Intergenic
1176040820 20:63064867-63064889 CCAGCCTGAGTGCCACAGGCCGG - Intergenic
1176101049 20:63364759-63364781 CCACCCTGGGGGACACAACCAGG + Intronic
1176118804 20:63445004-63445026 CCATCCTGGGCCCCACAGGCAGG - Intronic
1176146579 20:63568189-63568211 CCACCCTCGGTGCCCTGAGCTGG + Intronic
1176199981 20:63855762-63855784 CCACCCCTGCTGACACAAGCTGG + Intergenic
1176707276 21:10125756-10125778 CCACCAGGGGTACCACAAGGTGG + Intergenic
1178035356 21:28576738-28576760 CCAGCCTGGGTGACACGAGTGGG - Intergenic
1179601935 21:42485133-42485155 CCACCATGGGTGCTAGAAGCTGG + Intronic
1179909185 21:44438938-44438960 CAGCCCTGGGAGCCACAGGCAGG - Intronic
1181084072 22:20431254-20431276 CCAGCCTGCGTGGCACAGGCAGG + Exonic
1183425527 22:37737159-37737181 GCATGCTGGGTGCCACAGGCCGG + Intronic
1184179219 22:42808366-42808388 CCAGCCTGGGTGACAGAAGGAGG + Intronic
1184235977 22:43183224-43183246 CCACCCGAGGTGCCACACCCAGG + Intronic
1184236099 22:43183806-43183828 ACGCCCTGTCTGCCACAAGCCGG + Intronic
1185181127 22:49364043-49364065 CCACCCTGTGTGACACCAACAGG - Intergenic
1185381004 22:50507563-50507585 CCACCCTGGGTGCCTTCACCTGG + Exonic
950286187 3:11747090-11747112 CCAGCCTGGGTGACAGAAGGAGG - Intergenic
950470915 3:13185839-13185861 CCATCCTGGATGCCACTGGCTGG + Intergenic
952672200 3:35983538-35983560 CCACTCTGGGTGACAGAGGCAGG - Intergenic
952900491 3:38108909-38108931 CCACCCTGGTGGCCTCCAGCGGG - Intronic
953627965 3:44586281-44586303 CAACCCTGGTGCCCACAAGCAGG - Intronic
953637505 3:44675674-44675696 CCAGCCTGGCTGCCCCTAGCAGG + Intergenic
954899418 3:54006352-54006374 CCAGCCTGGGTGACACAACTAGG - Intergenic
955044554 3:55347613-55347635 AAACCCTGGGTGTCACCAGCTGG - Intergenic
955153526 3:56392867-56392889 CCACACTGGGTGCCACAGGCAGG + Intronic
956607988 3:71092344-71092366 CCAGCCTGGGTGACAGAAGGAGG + Intronic
957525329 3:81372221-81372243 CAAACCTGGGTACAACAAGCAGG + Intergenic
960692570 3:120362154-120362176 CCATCCTGGGTCCCAGCAGCAGG + Intergenic
961386541 3:126526240-126526262 CCTCCCTGTGTGCCACCTGCAGG - Intronic
962542084 3:136392734-136392756 CCACCCTGGGTGACAGAGCCAGG + Intronic
962751068 3:138435117-138435139 CCAGCCTGGGTGAGCCAAGCCGG + Exonic
967914923 3:194571625-194571647 CCACCCTGGCTTCCTCGAGCAGG + Intergenic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
968545007 4:1193999-1194021 CCCCCCTGGGTTCCACATACTGG - Intronic
968727118 4:2252832-2252854 CCACCCTGGAGTCCACATGCAGG + Intronic
969658174 4:8509922-8509944 CCCCCTTGGGTGCCACACCCAGG - Intergenic
969818676 4:9704790-9704812 CCACCCTGGCTGTGAGAAGCAGG + Intergenic
970438363 4:16057494-16057516 TCACCCTGGGAGCCAGAAGGTGG - Intronic
971289360 4:25322542-25322564 CCACCCTGGGTGACACAGTGGGG - Intronic
973853367 4:54984939-54984961 CCAGCCTGGGTGACAGAACCAGG - Intergenic
974063095 4:57053261-57053283 GCACCCTGGGAGCCCGAAGCGGG - Intronic
978061567 4:104345613-104345635 CCAGCCTGGGAGCCACAGGCTGG + Intergenic
978624224 4:110666220-110666242 CCTTCTTGGGTGCCACAGGCAGG - Intergenic
980912455 4:139005992-139006014 CCAGCCTGGGTGACACAACAAGG + Intergenic
982206064 4:152997996-152998018 CCTCTCTGGGTGCCAAAGGCAGG + Intergenic
984772092 4:183444833-183444855 CCACCCAGGCTGCCACCCGCGGG - Exonic
984816166 4:183838724-183838746 CCACAATGGGTGCCCCAAGTGGG - Intergenic
985297888 4:188455185-188455207 ACACCTTGGGTGCCTCAAGCTGG + Intergenic
986340947 5:6788770-6788792 CCACCCTGGATGCCGGCAGCAGG - Intergenic
986797810 5:11229491-11229513 CCAGCCTGGGTGACAGAAACAGG + Intronic
991611468 5:68454036-68454058 CCAGTCTGGGTGGCACCAGCTGG + Intergenic
993902674 5:93595299-93595321 CGCCCCTAAGTGCCACAAGCGGG - Intergenic
994187368 5:96830207-96830229 CCAGCTTGGGGACCACAAGCTGG - Intronic
997267017 5:132500906-132500928 CCTCCCTGGGTGCCCCATTCTGG + Intergenic
999145555 5:149390998-149391020 CCAGCCTGGGTGACAGAATCAGG - Intronic
1000187345 5:158872224-158872246 CCAGCCTGGGTGACACAATGAGG - Intronic
1000936871 5:167312930-167312952 CCAGCCTGGGTGACAGAAGGAGG - Intronic
1004335851 6:14763804-14763826 CCACCCTGTCTCCCACAGGCTGG + Intergenic
1004419988 6:15460732-15460754 CCAGCCTGGGTGACACAGGGTGG - Intronic
1007337396 6:41163338-41163360 CCACCCTGGCTGGCACCAGCAGG - Intergenic
1012982799 6:105847521-105847543 CCAGCCTGGGTGCCACAGCAAGG + Intergenic
1014342868 6:120230167-120230189 CCACCTTGGGCCCCAAAAGCAGG + Intergenic
1014772849 6:125476487-125476509 CCAGCCTGGCAGACACAAGCCGG - Intergenic
1017045501 6:150343914-150343936 CCACCCTCAGTGCCACAAGAGGG - Intergenic
1018251627 6:161877487-161877509 CCAGCCTGGGTGACACAACGAGG - Intronic
1018763619 6:166911869-166911891 CCAGCCTGGGTGACAGAGGCTGG - Intronic
1019743080 7:2684765-2684787 CCCTCCTGGGTGCCCCAAGTTGG - Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1021997395 7:26193610-26193632 CCACCCTGGTTGCCATATCCAGG + Exonic
1022559802 7:31336487-31336509 CCGCCCCTTGTGCCACAAGCAGG - Intergenic
1022801358 7:33780285-33780307 GCACCCTGTGTGCCACAGGGAGG - Intergenic
1025649903 7:63456936-63456958 CCAGCCTGGGTGACACAGGGAGG - Intergenic
1025771290 7:64509877-64509899 CCACCCTGGGTCACACAAAAGGG + Intergenic
1026010554 7:66632455-66632477 CCAGCCTGGGTGACACAGGCTGG + Intronic
1026588053 7:71673642-71673664 CCAGCCTGGGGGGCACAGGCTGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028237029 7:88374456-88374478 CCACCGTTTGTGCCACAAGTGGG - Intergenic
1028998704 7:97129992-97130014 CCACCTTGGGTGCCAGCATCAGG + Intronic
1029627230 7:101727576-101727598 CCAGCCTGGGTGACACAATGAGG + Intergenic
1029925940 7:104316989-104317011 CCACCCTGGGTGACATAGGGAGG + Intergenic
1033098331 7:138449766-138449788 CCCCCCAGGCTGCCACAAGGGGG + Intergenic
1033448804 7:141444785-141444807 CAACACGGGGTGCCAAAAGCAGG - Intronic
1034470222 7:151250927-151250949 CCACCATGGGTGCGTCTAGCAGG + Intronic
1034887201 7:154806920-154806942 CCACGCTGGGTGCCGCAAGCTGG - Intronic
1035208943 7:157313583-157313605 CCAGCCTGGGTGACAGAATCAGG + Intergenic
1036405060 8:8447452-8447474 CCAGCCTGGGTGACAAGAGCAGG - Intergenic
1039056641 8:33542103-33542125 CCAGCCTGGGTGACACAGCCAGG + Intergenic
1039228697 8:35419446-35419468 CCACCCTGGGTGCCAGCATCTGG + Intronic
1041226263 8:55701582-55701604 CCAGCCTGGGTGACAAAAGAAGG + Intronic
1042666795 8:71215970-71215992 CTACCCTGGGAGCCAGAAGGTGG - Intronic
1044819385 8:96145386-96145408 GCGCCCTGGGGGCCACCAGCCGG - Exonic
1044972348 8:97632273-97632295 CCAGCCTGGGTGACAGAAGGAGG + Intergenic
1045230403 8:100300621-100300643 CCACCCTGGGTGACACAGTGAGG + Exonic
1048349379 8:133603791-133603813 GCACCCTGGGGGTCACAGGCTGG + Intergenic
1049662945 8:143828578-143828600 CCACCCAGGGTGCCATTTGCTGG - Intronic
1049826564 8:144672542-144672564 GCACCCTGGCTGCCAGGAGCTGG + Intergenic
1050876982 9:10651284-10651306 CTACCCTGTCTGCCACCAGCTGG + Intergenic
1052514516 9:29462778-29462800 CTACTCTGTGTCCCACAAGCAGG - Intergenic
1056589114 9:87951426-87951448 CCAGTCTGGGTAGCACAAGCTGG - Intergenic
1056595737 9:88006654-88006676 CGAAGCTGGGTGGCACAAGCCGG + Intergenic
1056758631 9:89398703-89398725 CCAACCTGGGTGCCACCCTCAGG + Intronic
1056901734 9:90606266-90606288 CCAGTCTGGGTGGCACCAGCTGG + Intergenic
1057239589 9:93396996-93397018 CCACCTTGGCTTCCACCAGCTGG + Intergenic
1057762820 9:97890370-97890392 CCACCCTGTGTACCAGAGGCTGG + Intergenic
1061014120 9:127972149-127972171 CCAGCCTGGGTCCACCAAGCAGG + Intronic
1061537042 9:131256726-131256748 CCATCCTGGGTGCCCCGGGCAGG - Intergenic
1061968917 9:134033055-134033077 CCAGCCTGGTCTCCACAAGCAGG + Exonic
1062273364 9:135719760-135719782 CCAAGCTGAGTGCCCCAAGCTGG + Intronic
1062403048 9:136380771-136380793 CCACCCAGGCTGCCCCAGGCTGG - Exonic
1185451287 X:281666-281688 CCACCTTGAGTCCCACACGCAGG - Exonic
1186884953 X:13903787-13903809 CCACCCTGGCTGCCAGACACAGG - Intronic
1187337999 X:18397411-18397433 CCAGCCTGGGTGACAGAAGGAGG - Intergenic
1190083995 X:47379448-47379470 CCAGCCTGGGTGACAAAGGCTGG - Intronic
1191149772 X:57208527-57208549 CCACGTTGGGTGCCACTTGCTGG + Intergenic
1194436512 X:93874077-93874099 CCACCCTGGGTCACACAAATGGG - Intergenic
1195065236 X:101233738-101233760 CCACCCAGGGTAGCACAGGCAGG + Intronic
1195748106 X:108138486-108138508 CCACCCTGGGCCCCACAGGCAGG - Intronic
1195989187 X:110665863-110665885 CCACCCTGCATGCCACTAGATGG - Intergenic
1196458879 X:115909572-115909594 ACACACTTGGTGCCAGAAGCAGG + Intergenic
1198323248 X:135540784-135540806 CCAGCCTGGGTGACAGAACCAGG - Intronic
1198848221 X:140936572-140936594 TCACCCTGTTTGCCAGAAGCTGG - Intergenic
1199005228 X:142688241-142688263 CCAGCCTGGGTGACAGAAGGAGG + Intergenic
1200061063 X:153483966-153483988 CATCACTGAGTGCCACAAGCTGG + Intronic
1200108680 X:153727948-153727970 CCACACTGGTTGCCACCATCAGG + Intronic
1200180610 X:154148217-154148239 CCAGCCTGGGTGCCAGAGCCAGG + Intronic