ID: 1096562062

View in Genome Browser
Species Human (GRCh38)
Location 12:52442822-52442844
Sequence GCAATGCTCGCCCTTTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096562062_1096562067 21 Left 1096562062 12:52442822-52442844 CCAGGCTAAAGGGCGAGCATTGC 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 34
1096562062_1096562065 16 Left 1096562062 12:52442822-52442844 CCAGGCTAAAGGGCGAGCATTGC 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1096562065 12:52442861-52442883 GTCCAGTAGATGCCTAGTTTAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096562062 Original CRISPR GCAATGCTCGCCCTTTAGCC TGG (reversed) Intergenic
900494991 1:2972235-2972257 GCTGTGCTCGCCCTTGGGCCTGG - Intergenic
917122072 1:171653158-171653180 GGAATGCTCTCCCTGGAGCCTGG - Intergenic
919004872 1:191884455-191884477 GCAATGATCTCCCCTTATCCAGG - Intergenic
921057376 1:211553462-211553484 GCAATCCTCCCACCTTAGCCTGG - Intergenic
922058089 1:222061008-222061030 TCAATGCTCTCCTTTCAGCCAGG + Intergenic
1069989066 10:72303449-72303471 GTAATACTCCCCCTTGAGCCAGG - Intergenic
1070644247 10:78190454-78190476 GCAATGCATTCCCCTTAGCCAGG - Intergenic
1074825661 10:117214094-117214116 GCAATGTTCACCATTTACCCAGG - Intergenic
1084030091 11:66476109-66476131 GCCATGCTCGCCGGTAAGCCAGG - Exonic
1084031133 11:66481121-66481143 GGAAGGCTCAGCCTTTAGCCAGG - Intronic
1085134138 11:74069744-74069766 GAAGTGCTCTCCCTTTGGCCTGG + Intronic
1091603405 12:1931071-1931093 GGAATGCTCAGCCTTGAGCCGGG + Intergenic
1092536590 12:9394852-9394874 GCCATGATCGCACTTAAGCCTGG - Intergenic
1092558084 12:9578472-9578494 GCCATGATCGCACTTAAGCCTGG + Intergenic
1094513213 12:31109445-31109467 GCCATGATCGCACTTAAGCCTGG - Intergenic
1095894962 12:47270819-47270841 GCAATGCTCTGCCTTGATCCTGG + Intergenic
1096562062 12:52442822-52442844 GCAATGCTCGCCCTTTAGCCTGG - Intergenic
1129654907 15:77517642-77517664 GCAATTCTGTACCTTTAGCCAGG + Intergenic
1129885922 15:79036843-79036865 GCTAGTTTCGCCCTTTAGCCTGG - Intronic
1135110694 16:19688640-19688662 CCAGAGCTCTCCCTTTAGCCTGG + Intronic
1138453426 16:57106946-57106968 CCAATGCTTGGCCTTTTGCCAGG - Intronic
1142611024 17:1109267-1109289 GCCTTGCTCCCCCTTTCGCCGGG - Intronic
1158415735 18:57248252-57248274 GCAATGCCCTCCCCTTATCCCGG - Intergenic
925359241 2:3266180-3266202 GCATTGTTCGCCCTTTAGCCGGG - Intronic
927516628 2:23675347-23675369 GCAATGCCCACCCTCTGGCCAGG + Intronic
932860932 2:75290585-75290607 GCAATCCTAGCCCTTCACCCAGG + Intergenic
942460974 2:176168768-176168790 GCGATCCTCCCACTTTAGCCTGG - Intronic
1169640188 20:7742644-7742666 GCAGTGCCCGCCCTTTATCCAGG - Intergenic
1173576979 20:44118533-44118555 ACATTGCTCGCACTTTGGCCAGG - Exonic
1179831982 21:44002600-44002622 GGTATGCCCGGCCTTTAGCCTGG - Intergenic
955509360 3:59664082-59664104 GCAATGCATGCCCTTTGGTCAGG - Intergenic
962142595 3:132806089-132806111 GAAATGCTCTGCCTTTTGCCTGG + Intergenic
964632483 3:158826904-158826926 GCAATCCTCCCGCCTTAGCCTGG + Intronic
968746917 4:2365052-2365074 CCACTGCTCGCCCTTCAGCCTGG - Intronic
968982239 4:3856595-3856617 TCATTGCTCGCCCTTGAGACAGG + Intergenic
981019552 4:140011052-140011074 GCACTGCTTGCACTCTAGCCTGG + Intronic
996901108 5:128542469-128542491 GCAATGCTTGCCCCTTATCTGGG + Intronic
998437179 5:142120970-142120992 GCTATGCTTGCTCATTAGCCTGG - Intronic
1003248098 6:4401079-4401101 TCTGTGCTAGCCCTTTAGCCTGG + Intergenic
1023994102 7:45148372-45148394 GCAGAGCTCGCCCCTTAGCCTGG + Intergenic
1024138285 7:46432925-46432947 GCAATGTTGCCCCTTGAGCCTGG - Intergenic
1043338294 8:79204380-79204402 GCAATTCTCCCTCCTTAGCCAGG - Intergenic
1047521624 8:125599457-125599479 GCCATGCTCGTCCCTTTGCCTGG + Intergenic
1050068638 9:1787396-1787418 GCAAGGCTCGCCCTTCTGCAGGG + Intergenic
1050698003 9:8300648-8300670 GCAATGTTTGCCCTTTTGACAGG + Intergenic
1055918355 9:81431519-81431541 CCCATCCTGGCCCTTTAGCCTGG - Intergenic
1187254327 X:17628408-17628430 GCAATGCTCTCCTTTGAGCCTGG - Intronic
1190191400 X:48280227-48280249 GCAATCCTCCCACTTTGGCCTGG + Intergenic
1196919964 X:120575497-120575519 GCAATGCCCGCCCTTTCGGCGGG + Exonic