ID: 1096562067

View in Genome Browser
Species Human (GRCh38)
Location 12:52442866-52442888
Sequence GTAGATGCCTAGTTTAGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096562062_1096562067 21 Left 1096562062 12:52442822-52442844 CCAGGCTAAAGGGCGAGCATTGC 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096562067 Original CRISPR GTAGATGCCTAGTTTAGGCG AGG Intergenic
919569876 1:199234818-199234840 GTAGGTGGCTAGTTTAGATGAGG + Intergenic
920019206 1:202941330-202941352 GTAGATGCCTTGCTGAGGAGGGG + Exonic
1064638971 10:17396410-17396432 GTGGATGCCTAGTGTAGCCATGG - Intronic
1069591938 10:69647574-69647596 GCATATGCCTACTTTAGGCTAGG + Intergenic
1087509161 11:99068201-99068223 GTAGATGCCTACTTTATTCTAGG + Intronic
1087956227 11:104291074-104291096 GTATATGCCGAGTTTTGGAGAGG + Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1117617700 14:57550683-57550705 GTAGATGACTAGTTGATGGGTGG - Intergenic
1124178865 15:27454339-27454361 GTAAATGCTTAGATAAGGCGTGG - Intronic
1136065248 16:27754219-27754241 GTAGATGCCTGGCTCTGGCGTGG - Exonic
1143959682 17:10705713-10705735 TTAAATGCCTATTTTAGGCCAGG + Intronic
1153052473 18:912684-912706 TTAGATCCCTATTTTAGGCTGGG - Intergenic
1166307236 19:41941585-41941607 ATACATGCCTAGTTTGGGGGGGG - Intergenic
927526962 2:23752892-23752914 CTAGAGGCCTAGTTTAGGGAGGG - Intronic
928734788 2:34275598-34275620 CTGGATGCCTACTTTAGGCCAGG - Intergenic
1169645103 20:7801653-7801675 GTAGGAGACTAGTTTAGGTGTGG - Intergenic
1173666938 20:44769744-44769766 GAAGATGCCCAGTTTAGGAGGGG + Intronic
1182021461 22:27085212-27085234 GTAGATGCCAAGGTTAGGGTGGG + Intergenic
951140648 3:19154524-19154546 GTAGATGCCAACTTTAGACTTGG + Intronic
962290228 3:134129631-134129653 GTGGATGCCTAGTTGAGAAGAGG - Intronic
972263836 4:37439826-37439848 GTAGGTGCCTTGTTTATGAGAGG - Intronic
977382120 4:96288541-96288563 ATAAATGCCTAGTATAGGCAGGG + Intergenic
991550220 5:67827301-67827323 GTGGATGGCTAGTTTAGTGGTGG - Intergenic
999538172 5:152541618-152541640 TTAGATGCTTAGCTTAGGAGTGG + Intergenic
1001479604 5:172078889-172078911 GAAGTTGCCTAGTTTAGGAGGGG - Intronic
1004908721 6:20261116-20261138 CTAGATGCATGGTGTAGGCGGGG - Intergenic
1004924943 6:20407191-20407213 GTTGATGCCAAGTTTAAGCTGGG + Intronic
1015831914 6:137379133-137379155 GTAGAGGTCTAGATTAGGCAGGG + Intergenic
1021607899 7:22427508-22427530 GGAGGTCCCTAGTTTAGGCGTGG + Intronic
1023045832 7:36209428-36209450 GTATATGCCTAGCTCAGGCTTGG - Intronic
1027566337 7:79799645-79799667 GTAGATACCTATTGTAGGAGTGG - Intergenic
1028101266 7:86823808-86823830 CTAGATCCCTAGTGTAGGCCAGG + Intronic
1037863252 8:22421793-22421815 GTGGATTTCTAGTTTAGGAGAGG + Exonic
1039925970 8:41932764-41932786 GTGGATGCCAAGTTTGGGGGTGG + Exonic
1050151484 9:2622492-2622514 GCAGAAGACTAGTTCAGGCGAGG - Intronic
1186855124 X:13618941-13618963 GTAGATGCTTAGTTTACCCAAGG + Intronic
1196823145 X:119719635-119719657 GTAGATACCTAGTTTGAGAGGGG - Intergenic