ID: 1096565052

View in Genome Browser
Species Human (GRCh38)
Location 12:52471388-52471410
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 3, 1: 0, 2: 2, 3: 48, 4: 401}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096565045_1096565052 -6 Left 1096565045 12:52471371-52471393 CCCTTTGCAGACCCCATCAGAGT 0: 3
1: 0
2: 0
3: 9
4: 132
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401
1096565044_1096565052 -5 Left 1096565044 12:52471370-52471392 CCCCTTTGCAGACCCCATCAGAG 0: 3
1: 0
2: 1
3: 16
4: 192
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401
1096565040_1096565052 15 Left 1096565040 12:52471350-52471372 CCCAACCCTATACATCTTCTCCC 0: 2
1: 0
2: 1
3: 10
4: 202
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401
1096565041_1096565052 14 Left 1096565041 12:52471351-52471373 CCAACCCTATACATCTTCTCCCC 0: 2
1: 0
2: 3
3: 12
4: 191
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401
1096565042_1096565052 10 Left 1096565042 12:52471355-52471377 CCCTATACATCTTCTCCCCTTTG 0: 2
1: 1
2: 2
3: 20
4: 258
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401
1096565046_1096565052 -7 Left 1096565046 12:52471372-52471394 CCTTTGCAGACCCCATCAGAGTA 0: 3
1: 0
2: 1
3: 10
4: 123
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401
1096565043_1096565052 9 Left 1096565043 12:52471356-52471378 CCTATACATCTTCTCCCCTTTGC 0: 2
1: 1
2: 0
3: 18
4: 285
Right 1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG 0: 3
1: 0
2: 2
3: 48
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902314242 1:15605779-15605801 CAGATGAAACTGAAGGATAGAGG - Intergenic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902577246 1:17386177-17386199 CCCATTAAACAGAAGCATGGGGG - Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
905320427 1:37112690-37112712 CAGAGTACATAGAAAGAGGGAGG + Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG + Exonic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916997163 1:170313378-170313400 CAAAGTAAATAAAAGGATAGAGG - Intergenic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917931373 1:179824892-179824914 CAGAGTTAAGAGAAGGGCGGGGG - Intergenic
918719758 1:187838282-187838304 CAGAATAGACAAGAGGATGGAGG + Intergenic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921731032 1:218578178-218578200 CATAGTAATCAGTAGGCTGGGGG + Intergenic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1069457739 10:68567085-68567107 CAGAGTAAAAAGATGGACGTTGG - Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1080514328 11:33006157-33006179 CAGAGTGAACAGATGTCTGGAGG + Intergenic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG + Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106909716 13:34450562-34450584 GAGAGTAAACAGGCGGGTGGTGG - Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1109968969 13:69739528-69739550 CAGACAAAATAAAAGGATGGAGG + Intronic
1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117416420 14:55500668-55500690 CAGGGTAAAGTGAAGGATTGTGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120695942 14:87645223-87645245 CAGAGTATACCTATGGATGGTGG - Intergenic
1122030150 14:98906171-98906193 CAGAGTCAACATTAGGATAGAGG - Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG + Intronic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1141110261 16:81265979-81266001 GATAGTAGACAGATGGATGGTGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1143111945 17:4557965-4557987 CAGAGTTATCTGAAGCATGGGGG - Exonic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1155719742 18:28996212-28996234 CAGAGTAGAAAGATGGATGCTGG + Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1158029078 18:52940474-52940496 CAGCGTAAATAGAATCATGGTGG - Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1158692339 18:59671783-59671805 CAGATTAGATAAAAGGATGGTGG + Intronic
1160446085 18:78927856-78927878 GAGAGTATACAGAAGCCTGGGGG - Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
925139614 2:1540809-1540831 CGGAGTAAACAGAAATATGCAGG - Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1178209881 21:30517503-30517525 CAGAGTGAACAGCATGATTGTGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952583322 3:34861503-34861525 TACAGTTAACAGAATGATGGCGG - Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG + Intronic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG + Intergenic
967654598 3:192031827-192031849 CAGAGTCCACAGATGCATGGAGG - Intergenic
969976880 4:11112086-11112108 CAGAGGAAACAGATGGCTGTTGG - Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974202077 4:58655530-58655552 CATAGAAAACAAGAGGATGGAGG - Intergenic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976841366 4:89436467-89436489 CAGAATAAACAGCACTATGGAGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
979343428 4:119556343-119556365 CATTTTAAACAGTAGGATGGGGG - Intronic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG + Intergenic
979767391 4:124478399-124478421 CAGAGTTTACAGAATGATTGTGG - Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
983057225 4:163112448-163112470 GAGAGGAAACACATGGATGGAGG + Intronic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
988410643 5:30881392-30881414 CAAAGTGAACACAAAGATGGAGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996714921 5:126579400-126579422 GGGAGTAAACGGTAGGATGGTGG - Intronic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG + Intergenic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG + Intergenic
1000154744 5:158539411-158539433 CAGAGCTAACAGAAGGAAAGAGG - Intergenic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1008971103 6:57369168-57369190 CACAGTAAATAGAAGGGTAGTGG - Intronic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1012729131 6:102858064-102858086 AATAGTACAAAGAAGGATGGAGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1018777611 6:167032012-167032034 CAGAGTTAACATAAGGATTCAGG - Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1039514309 8:38119311-38119333 AAGCGCAAACAGCAGGATGGAGG + Exonic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG + Intergenic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG + Intergenic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1046117932 8:109806795-109806817 CAGTTTGAACATAAGGATGGGGG + Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG + Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG + Intergenic