ID: 1096567297

View in Genome Browser
Species Human (GRCh38)
Location 12:52492562-52492584
Sequence CCTGCCAGGGAGACCTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096567297_1096567307 2 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567307 12:52492587-52492609 GGTGTTGCTCCTCTGGTCTGGGG 0: 1
1: 2
2: 0
3: 7
4: 153
1096567297_1096567309 21 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567309 12:52492606-52492628 GGGGACCCTGAAGTGCCCCATGG 0: 1
1: 2
2: 1
3: 15
4: 234
1096567297_1096567310 24 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567310 12:52492609-52492631 GACCCTGAAGTGCCCCATGGAGG 0: 1
1: 2
2: 1
3: 10
4: 145
1096567297_1096567311 25 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567311 12:52492610-52492632 ACCCTGAAGTGCCCCATGGAGGG 0: 1
1: 2
2: 1
3: 15
4: 162
1096567297_1096567305 0 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567305 12:52492585-52492607 AAGGTGTTGCTCCTCTGGTCTGG 0: 1
1: 2
2: 0
3: 9
4: 120
1096567297_1096567314 30 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567314 12:52492615-52492637 GAAGTGCCCCATGGAGGGCATGG 0: 1
1: 2
2: 0
3: 23
4: 247
1096567297_1096567304 -5 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567304 12:52492580-52492602 GCAGGAAGGTGTTGCTCCTCTGG 0: 1
1: 2
2: 0
3: 18
4: 172
1096567297_1096567306 1 Left 1096567297 12:52492562-52492584 CCCTCCTAGGTCTCCCTGGCAGG 0: 1
1: 1
2: 1
3: 28
4: 244
Right 1096567306 12:52492586-52492608 AGGTGTTGCTCCTCTGGTCTGGG 0: 1
1: 2
2: 3
3: 13
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096567297 Original CRISPR CCTGCCAGGGAGACCTAGGA GGG (reversed) Intronic
900181953 1:1315059-1315081 CCAGCCAGAGTGACCTAGGAAGG - Intronic
900190883 1:1351739-1351761 CCAGGCAGGAAGACCTAAGAGGG + Intergenic
900236983 1:1597642-1597664 TCTGCCAGGGAGGCCCAGGCAGG + Intergenic
900611568 1:3546656-3546678 GCTGCCAGGGAGGCCGAGGTGGG + Intronic
900611621 1:3546797-3546819 GCTGCCAGGGAGGCCGAGGTGGG + Intronic
901459088 1:9380967-9380989 CCTGCCACGGAGAGCTGGTAGGG - Intergenic
902338429 1:15767320-15767342 CCTCCCAGGTGGACCTGGGAGGG - Intronic
902549894 1:17212926-17212948 CAGGCCAGGGAGGCCTAGGGAGG - Intronic
902777246 1:18682758-18682780 CTTCCCAGGCAGACCCAGGAGGG - Intronic
903031011 1:20464413-20464435 CATGCCAGTGAGGCCCAGGATGG - Intergenic
905897726 1:41559425-41559447 CCTGCCAGGGAGGCCTGGGGTGG - Intronic
906693834 1:47810929-47810951 CCTGCCAGGGAGGACAAGGCGGG + Intronic
908730839 1:67225080-67225102 CCTTCCTAAGAGACCTAGGAGGG + Intronic
910117812 1:83751776-83751798 CCTCCTAGGGAGAGCTAGAAAGG - Intergenic
910200843 1:84697113-84697135 CATGCCAGGGAGGGCTAGGTGGG - Intergenic
913126460 1:115794907-115794929 TGTGCCATGGAGACATAGGAAGG - Intergenic
913962654 1:143352263-143352285 CCAGCCTGGGAGACATAGGGAGG + Intergenic
914057009 1:144177848-144177870 CCAGCCTGGGAGACATAGGGAGG + Intergenic
914081332 1:144413682-144413704 CATTCCAGGGAGACTTAGCAGGG - Intergenic
914122137 1:144788518-144788540 CCAGCCTGGGAGACATAGGGAGG - Intergenic
914176239 1:145282221-145282243 CATTCCAGGGAGACTTAGCAGGG - Intergenic
915586776 1:156848131-156848153 CCTACCACTGAGACCTAGGAGGG + Intronic
918048230 1:180954017-180954039 CCTGCCAGGGAGACTTGGGGGGG - Intergenic
920017690 1:202926993-202927015 CCTTGCAGGGAGACCAAGGATGG + Intronic
922786867 1:228287204-228287226 GGTGCCAGGGAGAGCCAGGAAGG - Intronic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
923392167 1:233523262-233523284 CATTCCAGGGAGACAAAGGAGGG + Intergenic
923617803 1:235552224-235552246 GCTGCCTGGGAGACCTGTGAGGG + Exonic
923741329 1:236657733-236657755 CCAGCCTGGGAGACCAAGCAAGG - Intergenic
924561211 1:245156978-245157000 GCCGCCAGGGAGAGCTGGGAGGG - Intronic
924890625 1:248274590-248274612 ACTGCCATGGAGACCTAGAAAGG + Intergenic
1063689152 10:8267704-8267726 GCTGTCTGGGAGACCGAGGAAGG + Intergenic
1064084362 10:12334103-12334125 TCTGCCAGGGAGCTGTAGGAAGG + Intergenic
1066409556 10:35153562-35153584 ACTGCCATGAAGACCTAGGTGGG + Intronic
1066634754 10:37489549-37489571 TCTGCCAGGGAGCTGTAGGAAGG + Intergenic
1068838976 10:61589090-61589112 CAGGCCAGGGAGACCTAGATAGG + Intergenic
1073095824 10:100979094-100979116 CTCCCCAGGGAGACCTGGGAGGG + Exonic
1073120930 10:101122222-101122244 GCAGCCAGGGATTCCTAGGATGG + Intronic
1075915149 10:126160527-126160549 CCTGGAAGGGAGAGCTGGGAAGG - Intronic
1075979224 10:126722590-126722612 CCTGCCAGGGAAAGCGAGGCAGG + Intergenic
1076806362 10:132861157-132861179 CCTGCCAGGGAGTGCGAGGGCGG - Intronic
1079094074 11:17499893-17499915 CCTTCCAGGCAGTCCTAGGCTGG - Intronic
1080514360 11:33006417-33006439 GCTGCCTGGGAGACCGAGGTAGG - Intergenic
1081845065 11:46234709-46234731 CCAGACAGGGAGGCCCAGGAAGG - Intergenic
1084422273 11:69066341-69066363 CCTGCTGGGGAGAGCTAGGCGGG - Intronic
1085171077 11:74450483-74450505 CCTGCGGGGGAGAATTAGGAGGG + Intergenic
1086333072 11:85773196-85773218 CCTGCCAGGGAGTCTTACAATGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086952927 11:92909334-92909356 CCAGACAGTGAGACCTAGGTGGG + Intergenic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1087139590 11:94752343-94752365 TCTGGCAGAGAGCCCTAGGAAGG - Intronic
1088741744 11:112773321-112773343 CATGCCAGGGACACCTAGAAGGG + Intergenic
1089621378 11:119724329-119724351 CCTGCCAGGGAGACAACAGAAGG + Intronic
1090374741 11:126280790-126280812 CTTGCCAGGGATACGCAGGAGGG + Intergenic
1090466463 11:126939035-126939057 CCTGCCAGGCACACATAGTACGG + Intronic
1090845076 11:130523521-130523543 CAAGCCAGGGAGAAATAGGAAGG - Intergenic
1093582054 12:20794226-20794248 CCTTCCAGAGAGCCCTAGGAAGG - Intergenic
1093634005 12:21442715-21442737 CCTGCCAGGGAACCCTAGAGTGG - Intronic
1096072543 12:48783236-48783258 CCTGCCAGGGGCACCGAGGGGGG + Exonic
1096265237 12:50117459-50117481 CCTGCCAGTGAGGCCTAAGAGGG - Intronic
1096561525 12:52439140-52439162 CCTGTCAGGGTGCCCTGGGAGGG - Intergenic
1096565277 12:52473111-52473133 CCTGCTAGGGAGACCTAGGAGGG - Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1096694018 12:53337528-53337550 CCTGACAGGGAGAGCTGGGAGGG - Intronic
1097175904 12:57142851-57142873 CCTGCCAGGAAGAGTTGGGATGG - Intronic
1103204305 12:119116389-119116411 CTTACCAGGGAGACAAAGGATGG + Intronic
1103546173 12:121703210-121703232 CCTCCCAGGGAGATCCAGGCAGG - Intergenic
1103795150 12:123498325-123498347 CCTGCCTGGGAGGCTTAGGCAGG - Intronic
1104495407 12:129232462-129232484 CCTGCAAGGCAGAGCTAGCATGG - Intronic
1105001974 12:132695942-132695964 CCTGCCAGGGGGACCTCAGGAGG - Exonic
1106243544 13:27928279-27928301 CCTTCCAGGGAGGCCCAGGGAGG + Intergenic
1106562754 13:30860812-30860834 CTTGTCAGGGAGGCCAAGGAAGG + Intergenic
1106709252 13:32313394-32313416 CCTGCCTGGGAGACAGAGCAAGG - Intronic
1115640498 14:35332734-35332756 CATTGCAGGGAGACCTGGGAAGG + Intergenic
1117505824 14:56401844-56401866 GCTGCCAGGGTAGCCTAGGATGG + Intergenic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119881494 14:78103434-78103456 CCTGCAAGGGAGCCCTCAGAGGG - Intergenic
1121215956 14:92248036-92248058 CGTGCCTTGGAGACCTACGAGGG - Intergenic
1122761452 14:104031563-104031585 CCAGCCAGGGAGTCCAAGGCTGG - Intronic
1129920935 15:79318588-79318610 CCTGGCAGGGAGCACTAGGGAGG + Intronic
1131684935 15:94758162-94758184 TGAGCCAGGGAGAGCTAGGATGG - Intergenic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134875131 16:17691313-17691335 CCTGCCAGGAAGCTCTTGGATGG + Intergenic
1135354384 16:21757320-21757342 CCTGACAGGGAGGACAAGGAAGG - Intronic
1135452875 16:22573460-22573482 CCTGACAGGGAGGACAAGGAAGG - Intergenic
1136471478 16:30483700-30483722 CCGGCCTGGGAGATCCAGGAAGG + Intronic
1140122858 16:72098655-72098677 CCTCCCAGGTAGACCTTGAAGGG - Exonic
1140277716 16:73525719-73525741 CCTCCTAGAGAGACCAAGGAAGG + Intergenic
1140508096 16:75487205-75487227 CTGGCCTGAGAGACCTAGGAAGG + Intronic
1141285500 16:82668097-82668119 CCTGCCAGGGAGACCTGCCTGGG + Intronic
1141915547 16:87094063-87094085 TCTGGCAGGGAGACCCGGGATGG + Intronic
1142672832 17:1495128-1495150 CCTGACAGAGAGAACTGGGAAGG - Exonic
1143103082 17:4514688-4514710 CTAGCCAGGGAGACCCAGGAAGG - Intronic
1144668476 17:17118107-17118129 CCAGCCAGGGCTACCTAGGCTGG - Intronic
1144690362 17:17258140-17258162 CCTGCCAGAGGGACCTGGGGAGG - Intronic
1145976331 17:28986307-28986329 CCTCCCAGGGAGTCCCAGGCTGG - Intronic
1147338127 17:39739081-39739103 TCTGCCAGGGAGACCCAGACCGG - Intronic
1147391532 17:40112325-40112347 CAAGCCGGGGAGCCCTAGGAGGG - Intergenic
1148637370 17:49159028-49159050 GCTGTCAGGGTGACCTAGGGTGG - Exonic
1148734253 17:49855865-49855887 GCTGACATGGAGACCTAGGTAGG + Intergenic
1149895727 17:60426920-60426942 CCTGGCAGTGAGCCCTGGGAAGG - Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151594363 17:75068074-75068096 CCTACCAGGTTGAGCTAGGAGGG + Intergenic
1152682635 17:81677007-81677029 CCAGCCAGGGAGCCCTATGCAGG - Intergenic
1152947084 17:83203772-83203794 CCTGCAAGGGACCCCTAGGAAGG - Intergenic
1156454796 18:37286906-37286928 CCTCCCCGCGAGACCCAGGAGGG + Intronic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1158420352 18:57287614-57287636 CCTGCCACAGAAACCGAGGAGGG - Intergenic
1160895562 19:1400461-1400483 CCAGCCAGGGAGGCCGAAGACGG + Intronic
1161048642 19:2150738-2150760 CCTCCCCGGGAGACCGAGGCAGG - Intronic
1161051507 19:2166206-2166228 CCTACCAGGGAGGCCGAGGCAGG - Intronic
1161233358 19:3186443-3186465 CGGGGCAGGGAGACCTAGGCAGG - Intronic
1161342384 19:3750362-3750384 ACTTCCTGGGAGGCCTAGGAAGG + Intronic
1161541195 19:4852371-4852393 ACTTCCAGGGAGACCGAGGCGGG + Intronic
1162716550 19:12638075-12638097 GCAGCCAGGGAGGCCCAGGAAGG - Intronic
1163101691 19:15101195-15101217 CCAGCCAGGGAGGCCTAGGCAGG + Intergenic
1163270695 19:16251721-16251743 CCTTCCTGGGAGATCCAGGAGGG - Intergenic
1163849924 19:19656966-19656988 GCTGCCAGGGAGACCCAGGTTGG - Intronic
1164004051 19:21133043-21133065 CTTGCCAAGGAGATCTGGGAAGG + Intergenic
1166430693 19:42724386-42724408 TCTGCCATGGAGACCTGGCAGGG - Intronic
1166443709 19:42839739-42839761 CCTGCCATGGAGACCTGGCAGGG - Intronic
1202696492 1_KI270712v1_random:130521-130543 CCAGCCTGGGAGACATAGGGAGG + Intergenic
925560173 2:5183215-5183237 ACAGGCATGGAGACCTAGGACGG + Intergenic
926172542 2:10561409-10561431 CCTGGAAGGCAGACCTAGCAAGG + Intergenic
928241774 2:29592701-29592723 CCTGCAAGGGAGACCTTGTGTGG + Intronic
928762996 2:34606507-34606529 CCAGCCTGGGAGCCCTAAGAGGG + Intergenic
931185382 2:59945940-59945962 CATGCCTGGGAGACTTGGGAAGG - Intergenic
931256977 2:60582317-60582339 CCTGCCCTGGTGACCTAGGAGGG + Intergenic
932276330 2:70454748-70454770 TCTGGCAGGGAGACCAAGGCTGG + Intronic
933759322 2:85663250-85663272 GCAGCCAGAGACACCTAGGATGG - Intronic
934277654 2:91587546-91587568 CCAGCCTGGGAGACATAGGGAGG + Intergenic
934661662 2:96146387-96146409 CTGGACAGGGAGGCCTAGGATGG - Intergenic
935010314 2:99128992-99129014 AATCCCAGGGAGACCTAGGCGGG - Intronic
935636689 2:105254643-105254665 CCTGCCAGGCTGGCCTAGGAAGG + Intergenic
936029150 2:109057844-109057866 CCAGCCAGGCAGACCCAGGCAGG - Intergenic
937127540 2:119484019-119484041 CCTGCCAGGGCTCCCTGGGAAGG - Intronic
938380083 2:130831686-130831708 CCTGGCAGGGTGACCTGGAAGGG - Intergenic
940266554 2:151844974-151844996 CCTTCCAAGGATACCTAGGCCGG + Intronic
944660257 2:201915940-201915962 CCTGCCTGGGAGACCAGGCAAGG + Intergenic
944711027 2:202335512-202335534 CCTACCAGGGACTCGTAGGAAGG - Intergenic
945177146 2:207054182-207054204 CATGGCAGGGATACCTGGGAGGG + Intergenic
946853503 2:223930575-223930597 CATGCCTGGGAGGCCAAGGAGGG - Intronic
948697916 2:239742637-239742659 CCTGCCAGGGAGCCTTGGGACGG + Intergenic
948984240 2:241510216-241510238 CCAGCCTGGGAGACCGAGCAAGG + Intergenic
1168998163 20:2147731-2147753 GCTGCCAGACAGGCCTAGGAGGG - Exonic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1175327680 20:58141150-58141172 GCTTACAGAGAGACCTAGGAGGG - Intergenic
1175353611 20:58344544-58344566 GCTGCCAGAGACACCTTGGAAGG - Intronic
1176046701 20:63096679-63096701 CCGGCCCGGGAGACCCACGAGGG + Intergenic
1176080344 20:63269387-63269409 CTTGCAAGGAAGCCCTAGGAGGG + Intronic
1176132646 20:63502806-63502828 TCTACCAGGGAGGCCCAGGAGGG + Intergenic
1176257735 20:64160886-64160908 CCTGCCAGGCAGATCCAGGCAGG - Intronic
1179185212 21:39080573-39080595 GCTGCCAGGGAGAGCGAGCAGGG + Intergenic
1179634153 21:42696678-42696700 CGTGCCAGGGTTGCCTAGGAAGG - Intronic
1179797999 21:43796880-43796902 CCTGCCAGGGAGAGCTCTGGTGG + Intronic
1181527961 22:23500938-23500960 CCCACCAGGGAGCCCCAGGAAGG - Intergenic
1181552344 22:23647780-23647802 GCTGCCAGGGAGGCTGAGGAGGG - Intergenic
1181879549 22:25967317-25967339 TATGCCAGGGAGGCTTAGGAAGG + Intronic
1183245448 22:36689862-36689884 GCTGCCAGGGTGACCTAAAATGG + Intronic
1184719527 22:46302484-46302506 GCTACCAGGGAGGCTTAGGAAGG - Intronic
1184853679 22:47135190-47135212 CCTGCCAGGGGGTTCTGGGAAGG - Intronic
1184939364 22:47749806-47749828 GCTGCCAGGGAGCCCTGGGTGGG - Intergenic
1185012240 22:48320788-48320810 CCTGCCTGGGAGTCCCAGGCAGG - Intergenic
949641259 3:6037681-6037703 CAGGCCCTGGAGACCTAGGAGGG - Intergenic
950705213 3:14775250-14775272 CCTGTCAGGGAGACATGGAATGG + Intergenic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
958435188 3:94087780-94087802 GCTACCTGGGAGACCGAGGAGGG - Intronic
960029372 3:113041999-113042021 GATGCCAGGGACCCCTAGGATGG + Intergenic
960950260 3:122994477-122994499 CATGGCAGGGAAACGTAGGAAGG - Intronic
961473402 3:127132469-127132491 CCCCCCAGGGAGACATAGGGTGG + Intergenic
962475624 3:135752794-135752816 CCATCCGGGGATACCTAGGATGG - Intergenic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
962736517 3:138329949-138329971 CCAGCCAGGGAGAGGCAGGAGGG + Intergenic
963262867 3:143210524-143210546 CCTTCCAGGAAGAACAAGGATGG + Intergenic
965539151 3:169855042-169855064 GCTGCTAGGGAGACCAAGGCAGG + Intronic
968307654 3:197659919-197659941 CCTGCCCGGGATACGTGGGACGG + Intergenic
968831372 4:2934360-2934382 CCCGCCAGGGAGACCGAGTCCGG - Exonic
968966941 4:3773527-3773549 CCTGCCCGGGAGCCCTAGGAGGG - Intergenic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969126420 4:4951620-4951642 CCTGGCACCGAGACCTAGGTAGG + Intergenic
969248937 4:5954571-5954593 CCTGCCGTGGAGGCCTAGGTGGG - Intronic
969366005 4:6694611-6694633 CCTGGCAGGGAGCCCAAGGGAGG - Intronic
969388550 4:6873469-6873491 CCTCTCAGGAAGAGCTAGGAGGG + Intronic
969429340 4:7145092-7145114 CCCAGCATGGAGACCTAGGATGG + Intergenic
975835582 4:78419461-78419483 TCTGCCAGGGAGCCCAAAGAGGG + Intronic
981242351 4:142492917-142492939 ACAGCCCTGGAGACCTAGGAGGG + Intronic
981915324 4:150026889-150026911 ACAGCCCTGGAGACCTAGGAGGG + Intergenic
986486618 5:8244407-8244429 CTTTCCAGGGTGACCCAGGAAGG + Intergenic
986684770 5:10267098-10267120 CCTGCAAGGAACACCTAGGTTGG - Intergenic
986707801 5:10465918-10465940 CTTCCCAGGGAGTCTTAGGAGGG - Intronic
988014849 5:25542279-25542301 CCTGTCTGGGAGCCCTATGAAGG - Intergenic
988486080 5:31669161-31669183 CCTGTCTGGGAGACCCAGGAGGG + Intronic
996087878 5:119322662-119322684 CCTGCAAAGAAGACCAAGGAGGG - Intronic
996862443 5:128082822-128082844 CCTGCCAGGCAGACCTAGATTGG - Intergenic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997590058 5:135066960-135066982 GCTGCCAGGGAGGCCTAACAGGG + Intronic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
999660402 5:153856609-153856631 TCTGCCAGGGAAACCCAGGATGG + Intergenic
1001564526 5:172690836-172690858 CCTGCCAGGGAGACACAGTGAGG + Exonic
1001696731 5:173675762-173675784 CCTGCCAGGCAGTCCTGGGTAGG - Intergenic
1002538001 5:179888777-179888799 CCTGGCAGGGAGACGGACGAGGG + Intronic
1003075020 6:2975999-2976021 CTGGGCAGGGAGACCTAGGAAGG + Intergenic
1003464188 6:6362730-6362752 ACTGCCAGCAAAACCTAGGATGG + Intergenic
1004204065 6:13574921-13574943 GCTGCCAGGGTGACCGAGGAAGG + Intronic
1004997047 6:21203622-21203644 GATGCCAGGGAGACCAAGGTGGG - Intronic
1005075085 6:21899092-21899114 CAAGCCAGGGAGACCTGGCAGGG + Intergenic
1009315551 6:62214659-62214681 TCTGAAAGGGAGACCTAGGAAGG + Intronic
1010866073 6:80978105-80978127 CAAGCCAGGGAAACCTAGGGAGG + Intergenic
1011014752 6:82742674-82742696 GCTGACTGGGAGGCCTAGGAGGG - Intergenic
1011340447 6:86307685-86307707 CCTGCCAGGGAACCCCAGAATGG + Intergenic
1011686752 6:89829874-89829896 GATGCCAGGGAGACCTCGGTGGG + Intronic
1013216209 6:108029458-108029480 CCTGCCATGCAGACCAGGGATGG - Intergenic
1014457529 6:121653806-121653828 CCTGCCAGGAAGTCCTTGAAAGG - Intergenic
1014802181 6:125790379-125790401 CCTGGCAGCGGCACCTAGGAGGG - Intronic
1016993827 6:149947225-149947247 CCTTCCAGGATGACCTAGGGTGG + Intronic
1017004506 6:150020312-150020334 CCTTCCAGGATGACCTAGGGTGG - Intronic
1017971439 6:159315636-159315658 CCTGCCAGGGGATCCTGGGAAGG - Intergenic
1019441545 7:1050015-1050037 CCCGCCAGAGAGACCTGGGAGGG - Intronic
1019748326 7:2712955-2712977 CCTGCCAGGGATAAAGAGGAAGG + Exonic
1020277241 7:6632150-6632172 CCTGCCAGTGAGACACACGAAGG + Intergenic
1023335166 7:39161498-39161520 CCTGCCAGGCAGATCCAGGCTGG + Intronic
1023628476 7:42139753-42139775 CCAGCCAGGGACGCCTGGGAGGG + Intronic
1027861891 7:83594554-83594576 CCTTCCAGAAAAACCTAGGAAGG - Intronic
1029106535 7:98181385-98181407 GCTACCTGGGAGGCCTAGGAGGG - Intronic
1032509004 7:132456806-132456828 CCCACCTGGGAGACCTTGGATGG + Intronic
1033414844 7:141152552-141152574 CCTGACTGGGATACTTAGGAGGG + Intronic
1033458110 7:141520700-141520722 CCTGCCATGGAGAACAGGGACGG - Intergenic
1033598235 7:142871330-142871352 CCTGCCTGGGTGCCCTGGGAAGG + Exonic
1035122229 7:156578471-156578493 CCTGCCAGGGAGGAAAAGGAGGG + Intergenic
1035403784 7:158586124-158586146 CCTGCCTTGGAGTCCTGGGAGGG - Intronic
1037427153 8:18768357-18768379 ACTGCCTGGGAGGCCCAGGAAGG + Intronic
1037749059 8:21668155-21668177 GCTGCCAGGAGGACCCAGGAGGG - Intergenic
1037790958 8:21941263-21941285 CCTTCTAGGGAGACCGAGGTAGG - Intronic
1038367744 8:26953708-26953730 ACTGGCAGGGAGAACTTGGAAGG + Intergenic
1039226709 8:35396525-35396547 CCAGCCTGGGAGACCGAGGGAGG - Intronic
1039907343 8:41796816-41796838 GCTGCCAGGCAGAGATAGGACGG + Intronic
1041398863 8:57419947-57419969 AGCGCCAGTGAGACCTAGGACGG - Intergenic
1041521995 8:58767299-58767321 GCTGCCAGGCAGGCTTAGGAGGG + Intergenic
1042824152 8:72963297-72963319 CCTGGCAGGGAGGCCAAGGTGGG + Intergenic
1044533202 8:93331185-93331207 CCTGCCAGATAGAACAAGGAGGG - Intergenic
1047457813 8:125032047-125032069 CCTGGCAGGGTGACTAAGGATGG + Intronic
1047533578 8:125698961-125698983 CCTGCAAGTGAAACCTGGGAAGG + Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048469905 8:134696572-134696594 CCAGCCAGGGATAACTAGGATGG - Intronic
1049176172 8:141194011-141194033 CCTGCCAGGGAGAAACGGGAGGG - Exonic
1049309010 8:141923570-141923592 CCTGCCAGGGAAAGCCAGGGAGG - Intergenic
1049519311 8:143080159-143080181 CCGGCCAGGCAGATCCAGGAAGG - Intergenic
1051302632 9:15669077-15669099 CTTGCCAGGCAGACCTCGGCAGG + Intronic
1051499275 9:17759238-17759260 CCTTCCAGAGAGGCCCAGGATGG + Intronic
1053266412 9:36717556-36717578 CCTGGCTGGGAGACTTAGCAGGG + Intergenic
1053382495 9:37660296-37660318 CCTTGCAGGGAGATCTAGGAGGG + Intronic
1057406229 9:94773302-94773324 CCTGCCAGGGAAAACAAGCAGGG + Intronic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057842856 9:98500410-98500432 CCTGGAAGGGAGCCCCAGGAGGG + Intronic
1058573925 9:106379750-106379772 CCAAAAAGGGAGACCTAGGAAGG - Intergenic
1060411441 9:123403015-123403037 TCGGCCATGGAGGCCTAGGAAGG + Intronic
1061014311 9:127973091-127973113 CTTACCAGGGAGCCCCAGGAAGG - Intronic
1061422945 9:130481994-130482016 CCCTCCAGGGAGAGCTGGGAGGG + Intronic
1061537043 9:131256726-131256748 CCTGCCCGGGGCACCCAGGATGG + Intergenic
1061937745 9:133867546-133867568 CCTGCCAGGGGGTCCTGGAAAGG - Intronic
1062161585 9:135083359-135083381 CCTGCCAGGGAGAGTGCGGAGGG + Intronic
1062189813 9:135242230-135242252 CCTGCCTGGGTGGCCTTGGAGGG - Intergenic
1062463555 9:136671697-136671719 CCTGCCAGGGACCCCAAGGCTGG + Intronic
1187070158 X:15879809-15879831 ACAGCCCTGGAGACCTAGGAGGG - Intergenic
1190689381 X:52900826-52900848 GCAGTCAGGGAGACCTGGGAGGG + Intronic
1190696602 X:52954966-52954988 GCAGTCAGGGAGACCTGGGAGGG - Intronic
1195002239 X:100653042-100653064 AATGCCATGGAGACCAAGGAAGG - Intronic
1199603832 X:149560705-149560727 TCTGCAAGGGAAACCAAGGATGG + Intergenic
1199646557 X:149918769-149918791 TCTGCAAGGGAAACCAAGGATGG - Intergenic
1199893959 X:152114980-152115002 CCTGCCTGGGACTCCTATGATGG - Intergenic
1200243136 X:154508168-154508190 TCTCCCAGGGAGGCCTGGGAAGG - Intronic
1200983222 Y:9280909-9280931 TCTTGCAGGAAGACCTAGGAAGG - Intergenic
1201695753 Y:16823895-16823917 TCAGCCAGGGAGACAGAGGAAGG - Intergenic
1202127162 Y:21578787-21578809 TCTTGCAGGAAGACCTAGGAAGG + Intergenic