ID: 1096567850

View in Genome Browser
Species Human (GRCh38)
Location 12:52496236-52496258
Sequence GGCCCCACCACCACTAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096567845_1096567850 -10 Left 1096567845 12:52496223-52496245 CCACTTCTTCCCAGGCCCCACCA 0: 1
1: 0
2: 7
3: 107
4: 980
Right 1096567850 12:52496236-52496258 GGCCCCACCACCACTAAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1096567842_1096567850 21 Left 1096567842 12:52496192-52496214 CCTGCTGCTGCCGGAAGATCTAT 0: 1
1: 0
2: 1
3: 27
4: 139
Right 1096567850 12:52496236-52496258 GGCCCCACCACCACTAAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1096567843_1096567850 11 Left 1096567843 12:52496202-52496224 CCGGAAGATCTATTTCTGATTCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1096567850 12:52496236-52496258 GGCCCCACCACCACTAAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096567850 Original CRISPR GGCCCCACCACCACTAAAAG GGG Intergenic
901185226 1:7368562-7368584 GGCCCCACCCCCACTAGCACAGG + Intronic
901902077 1:12373431-12373453 GGCCCCCCCACCAAAAAAAAAGG - Intronic
902796126 1:18801349-18801371 AGCACCACCACCACCAAAACCGG + Intergenic
903273008 1:22203516-22203538 GGCCCCACCAACTCCAAAGGAGG + Intergenic
906256740 1:44356105-44356127 GGCCCTACCACCTCTGAGAGCGG + Intergenic
912474128 1:109924886-109924908 AGCCCCACCACCACGAAGAGGGG - Intronic
912742364 1:112212139-112212161 GGACCCACCACCGCTCAAGGAGG + Intergenic
918320114 1:183356225-183356247 TGCCCTACCACTACTAAAGGAGG - Intronic
918383766 1:183984553-183984575 GGCCACAGCTCCCCTAAAAGTGG - Intronic
921937011 1:220804742-220804764 CCCCCCACCACCAGTCAAAGTGG + Intronic
922411578 1:225381162-225381184 GGCCGCACCCACACTACAAGGGG + Intronic
922435339 1:225599826-225599848 GGCCCCACCTCCAATAAAGGGGG - Intronic
922476223 1:225908581-225908603 GGGCCCACCTCCCCTTAAAGAGG + Intronic
1068632772 10:59314686-59314708 GACCCCACCCCCACTTAAATGGG + Intronic
1070164260 10:73886112-73886134 GGCACCACCACCAATATAAGCGG - Intergenic
1072739535 10:97901186-97901208 AGCCACACTACCACAAAAAGGGG - Intronic
1075738107 10:124676580-124676602 GGCCCCACCAGCACAAAAGATGG + Intronic
1077089123 11:770468-770490 GCCCCCACCAACAGTGAAAGAGG + Exonic
1080839854 11:35973830-35973852 CTCCCCACCAGCACTAAATGAGG + Intronic
1085318547 11:75560903-75560925 TTCCCCACAACCACTAACAGAGG + Intergenic
1085669984 11:78454293-78454315 GGCCCCACCTCCAATATTAGAGG - Intronic
1089616246 11:119696496-119696518 TGCCCCACCCCCACTGAGAGCGG + Intronic
1089839236 11:121400074-121400096 GGCCCCACCTCCAACAATAGGGG - Intergenic
1093892235 12:24535849-24535871 GGTCCCAGCTCCACTATAAGCGG + Intergenic
1093994381 12:25625779-25625801 GGCCTCACCACCACCAAGACAGG + Intronic
1096114543 12:49047871-49047893 GGCCATACCACCTCTTAAAGCGG - Intronic
1096192854 12:49631523-49631545 GGCGCCACCACCACTCACACAGG + Exonic
1096567850 12:52496236-52496258 GGCCCCACCACCACTAAAAGGGG + Intergenic
1098633883 12:72757348-72757370 GACCCCACCACCTCTAGCAGTGG + Intergenic
1102623817 12:114218615-114218637 GACCCCACAACAACTAAATGAGG + Intergenic
1102802108 12:115744315-115744337 GGCCCAACCACCAGAAAATGAGG + Intergenic
1104101373 12:125615778-125615800 GGCCCCTACACCACTCACAGTGG - Intronic
1112505237 13:99971125-99971147 GGCTACACCACCACCAACAGTGG - Exonic
1121560712 14:94873439-94873461 GGCCCTTCCACCACTTCAAGGGG + Intergenic
1122158156 14:99763551-99763573 GGCCCCACCAGCCCTCAGAGAGG + Intronic
1128352498 15:66900504-66900526 GGCCCCACCCCCAATAATCGAGG - Intergenic
1129485531 15:75867631-75867653 GCCCCCATCACCTCAAAAAGGGG - Intronic
1129645000 15:77421071-77421093 AGTACCACCACCACCAAAAGAGG - Intronic
1134849092 16:17466007-17466029 GGCCCCGGCACCAATGAAAGAGG - Intronic
1140906589 16:79414531-79414553 GGCCCCACCTCCAATACTAGGGG + Intergenic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1144557489 17:16294900-16294922 GGCACCACCACCTCTAAGATAGG - Intronic
1147489255 17:40848933-40848955 GGCCCCACACCCAAGAAAAGAGG - Intergenic
1149473601 17:56940218-56940240 GCCCCCACCACCCCCAAAGGTGG + Intronic
1149664812 17:58358093-58358115 GGCACCACCACTACAAAAAGCGG - Exonic
1158402375 18:57132706-57132728 GGAGCCACCACTACTCAAAGGGG + Intergenic
1161740511 19:6018387-6018409 GGCCCCTCCAGCCCTAACAGGGG + Intronic
1167682468 19:50932476-50932498 GGCCCTCCCACCAATAAAATTGG + Intergenic
927850771 2:26497973-26497995 GCCCCCACCAACAATAAAAAAGG + Intronic
933644347 2:84798615-84798637 GGCCCCACCACCACTGCTACAGG + Intronic
933808065 2:86014459-86014481 GGCCCCACCAGCACTGAATCTGG - Intergenic
934247409 2:90319536-90319558 GGACCCACCACCTATAAAACCGG - Intergenic
934261916 2:91483067-91483089 GGACCCACCACCTATAAAACCGG + Intergenic
934525411 2:95048690-95048712 GGCCCCACCACCCCTACAGCAGG - Intronic
935783818 2:106531307-106531329 GTTCCCACTACCACTAAAAAGGG - Intergenic
942928037 2:181457162-181457184 GCCCCAACCACCGTTAAAAGGGG + Intergenic
944547720 2:200814054-200814076 CTCCCCACCACTACTACAAGGGG - Intronic
947808122 2:232982394-232982416 GCCCCCAGCACCCCTAAGAGAGG + Intronic
1168771993 20:421373-421395 GGCCCCCCCACCCCTGAATGTGG + Intronic
1172478772 20:35258712-35258734 GACCTCAACATCACTAAAAGTGG - Intronic
1174364136 20:50046202-50046224 GGCCACACCACCAGTTAATGGGG - Intergenic
1175749041 20:61482515-61482537 GGCTCCACCCACAGTAAAAGAGG - Intronic
1176039698 20:63058895-63058917 GGCCCCACCACCTGGGAAAGGGG - Intergenic
1182769531 22:32784208-32784230 AGCCCCACCATCACTCAAGGTGG - Intronic
950609653 3:14117760-14117782 AGGCTCACCACCATTAAAAGGGG - Intronic
954441709 3:50525720-50525742 GCCCCCACCACCACTCTCAGGGG - Intergenic
955083412 3:55678775-55678797 GCCCCCACCACCACCAATAATGG + Intronic
966569804 3:181428899-181428921 GGCCCCACCTCCAATATTAGAGG + Intergenic
968189627 3:196658462-196658484 GGCTCTACCACCACTAGCAGTGG - Intronic
968949927 4:3685237-3685259 GGCCCCTCCATCACGAGAAGGGG + Intergenic
973627654 4:52789297-52789319 GGTCCCAGCAGCACTGAAAGAGG - Intergenic
984552112 4:181173123-181173145 GGCCCCACCATTTCTAAAGGGGG + Intergenic
986629024 5:9751273-9751295 TCCCCCACCCCCACCAAAAGAGG + Intergenic
991114301 5:62936227-62936249 GTTCCCACCTCCACAAAAAGTGG + Intergenic
995520349 5:112998195-112998217 AGGGCCACCAGCACTAAAAGAGG - Intronic
996992359 5:129650471-129650493 CCCCCCACCACCACTAGTAGTGG - Intronic
997607753 5:135187369-135187391 GGCCTCACCGCCGCTAACAGCGG + Intronic
1000633284 5:163615380-163615402 GGCACCACCACCAAGAACAGGGG - Intergenic
1004134428 6:12952819-12952841 GTCCCCACCAGCAATAAATGAGG + Intronic
1004423867 6:15494710-15494732 TGCCCCACCCCCACTTAAGGGGG + Intronic
1012898479 6:104978861-104978883 GGCTCCACCCCCAATATAAGGGG + Intronic
1017760173 6:157562444-157562466 GGCCCCACCAACAGAAAATGAGG - Intronic
1018295998 6:162344674-162344696 AGCCCCACTACTACTAACAGTGG + Intronic
1021312614 7:19112322-19112344 GCCCCCAGCACCAGTGAAAGTGG - Intronic
1033387616 7:140893676-140893698 CGCCACACCACCAATAAAACAGG + Intronic
1033606741 7:142933144-142933166 TCCTCCACCGCCACTAAAAGGGG + Intronic
1041043014 8:53865780-53865802 AGCCCCATCTCCACTAAAAATGG - Intronic
1044199393 8:89415199-89415221 GGCCCCCCCACCACAAAACCAGG - Intergenic
1046792313 8:118335142-118335164 GGCACAGCCACCACTAAAGGAGG + Intronic
1047347854 8:124045860-124045882 AGCTCCACCACCACTAAGGGCGG - Exonic
1048228753 8:132616426-132616448 GACCCCACCACCACCACTAGTGG - Intronic
1051346346 9:16154333-16154355 GGCCTCCCCACCAGTAAAACTGG + Intergenic
1052890784 9:33697692-33697714 GGCCTCAGCAGCAGTAAAAGAGG + Intergenic
1056744260 9:89286546-89286568 GGCCCAATCACCACATAAAGGGG - Intergenic
1060279056 9:122203837-122203859 GGCCCAAGCACCACTATGAGAGG + Exonic
1060572550 9:124655989-124656011 GGCCCCACCACCAACATAAGGGG - Intronic
1062717772 9:138019613-138019635 GGCCTCACCACCACTAGGACAGG - Intronic
1192907456 X:75566778-75566800 GAGCCCACCACAACTAAAGGAGG - Intergenic
1194473341 X:94325773-94325795 GGCCCCACCTCCAATACTAGAGG + Intergenic
1194494394 X:94594147-94594169 GACCCCACCAGGACTAGAAGCGG + Intergenic
1197705446 X:129631415-129631437 GGCCCTACCATTCCTAAAAGAGG - Intergenic