ID: 1096567944

View in Genome Browser
Species Human (GRCh38)
Location 12:52496736-52496758
Sequence GACAGCTCCCACCTGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096567944_1096567951 22 Left 1096567944 12:52496736-52496758 CCTCCCTTCAGGTGGGAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1096567951 12:52496781-52496803 ATGCCTTTGTTCCAGGCCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 247
1096567944_1096567950 21 Left 1096567944 12:52496736-52496758 CCTCCCTTCAGGTGGGAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1096567950 12:52496780-52496802 AATGCCTTTGTTCCAGGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 241
1096567944_1096567949 15 Left 1096567944 12:52496736-52496758 CCTCCCTTCAGGTGGGAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1096567949 12:52496774-52496796 ATGCAGAATGCCTTTGTTCCAGG 0: 1
1: 0
2: 1
3: 24
4: 211
1096567944_1096567947 -9 Left 1096567944 12:52496736-52496758 CCTCCCTTCAGGTGGGAGCTGTC 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1096567947 12:52496750-52496772 GGAGCTGTCTCTGATTGCCTTGG 0: 1
1: 0
2: 2
3: 23
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096567944 Original CRISPR GACAGCTCCCACCTGAAGGG AGG (reversed) Intergenic
901762081 1:11478343-11478365 GCCAGCCCCCAGCTGCAGGGTGG - Intergenic
903544906 1:24117921-24117943 GACAGGTCCAACCTGAGGAGGGG + Intergenic
905394899 1:37660839-37660861 AACTGCTCCCACCAGCAGGGAGG - Intergenic
907020268 1:51060088-51060110 GGCAGCTCCTACCTGCAGGCAGG - Intergenic
907404892 1:54247745-54247767 GCCAGCCCCCACCAGAAGTGCGG - Intronic
915553386 1:156647735-156647757 GGCAGCACCCAGCAGAAGGGGGG - Intronic
920456350 1:206104557-206104579 GACAGCTCCCACCAGGAGAGGGG + Intergenic
920530132 1:206695847-206695869 GACAGCACCCGCAGGAAGGGGGG - Intronic
922536660 1:226386035-226386057 GAGAGCCCCCTCCTGAGGGGTGG - Intronic
923671633 1:236046530-236046552 GGAAGCTGCCACCTGTAGGGGGG + Intronic
923709796 1:236378107-236378129 ATCAGATCCCACCTAAAGGGGGG - Intronic
1063006716 10:1978762-1978784 CACAGATCCGACTTGAAGGGAGG - Intergenic
1069590804 10:69640774-69640796 GGCAGCTCCCACCTGGAGGAAGG - Intergenic
1070421563 10:76242471-76242493 GCCAGCTACCACCAGAAGTGGGG - Intronic
1070783624 10:79150913-79150935 GAGAGCACCCACCAGGAGGGAGG - Intronic
1070947672 10:80407132-80407154 GGCAGCTCCCAGATGAAGGGGGG + Intergenic
1072650478 10:97291205-97291227 CACAGCTCCCACACAAAGGGAGG - Intronic
1074395758 10:113096825-113096847 GCCAGCTCCCTCCAGAGGGGAGG + Intronic
1077145249 11:1041635-1041657 CTAAGCTCCCACCTGGAGGGAGG - Intergenic
1077338790 11:2016978-2017000 GGCAGCACCCACCCAAAGGGAGG + Intergenic
1078318393 11:10310549-10310571 AAAAGATCCCACCTCAAGGGTGG - Intronic
1082801946 11:57421285-57421307 GAAGGCTCCCACCTGCAGGTTGG + Exonic
1085519227 11:77128426-77128448 TACAGCTGCCACCTGCACGGAGG - Exonic
1089269158 11:117289564-117289586 GACATCTCCCTGCTGAAGTGAGG - Exonic
1090237387 11:125159591-125159613 GACAGCTCCCACCTGAGAGCTGG + Intergenic
1202821774 11_KI270721v1_random:72160-72182 GGCAGCACCCACCCAAAGGGAGG + Intergenic
1094495553 12:30987245-30987267 GTCTGGTCCCACCTGGAGGGTGG - Intronic
1096567944 12:52496736-52496758 GACAGCTCCCACCTGAAGGGAGG - Intergenic
1097107845 12:56635711-56635733 TGCAGCCCCCACCTGAAGGTGGG + Intronic
1097260825 12:57719172-57719194 GACTGCTCTCACCTGTAGGTTGG - Exonic
1098240659 12:68463814-68463836 GAGAGCTGGCATCTGAAGGGAGG - Intergenic
1099967850 12:89469697-89469719 GACAGCCTCCACATGAAGGAAGG + Intronic
1104674113 12:130701212-130701234 CTCAGCTCCCACCTGCTGGGGGG - Intronic
1104675121 12:130707286-130707308 AACGGTGCCCACCTGAAGGGAGG + Intronic
1104754866 12:131262639-131262661 GACAGCTGACAGCTGGAGGGAGG + Intergenic
1104806453 12:131592354-131592376 GGGAGCTCCCACCGGAAGGGTGG - Intergenic
1106821744 13:33472519-33472541 GACAACTCGCAACTGAGGGGAGG - Intergenic
1108555561 13:51588345-51588367 GACTGGTCCCACCTGGAGAGAGG - Intronic
1114648365 14:24268187-24268209 GACAGCTCACACCTGAGGGTGGG + Exonic
1118323805 14:64768517-64768539 CACAGCTCCTCCCTGAATGGTGG + Intronic
1118876943 14:69793905-69793927 GGCAGCTCCCTCCTCAAGGAAGG - Intronic
1119177781 14:72581938-72581960 GAAAGCTCCCACCAGAAGCCAGG - Intergenic
1122597267 14:102902345-102902367 GACCCCTCCCACCTGGATGGTGG - Intronic
1122905187 14:104798308-104798330 GACAGCTCCCCACTGCAGGCTGG - Intergenic
1124516374 15:30370254-30370276 GACAACTGCCCCCGGAAGGGAGG + Intronic
1124726544 15:32160477-32160499 GACAACTGCCCCCGGAAGGGAGG - Intronic
1125110411 15:36025775-36025797 GTCACCTCTCACCAGAAGGGAGG + Intergenic
1125718698 15:41834883-41834905 GGCAGCTCCCACCTGAAATAGGG - Exonic
1126431828 15:48594011-48594033 GACAGATCCATCCTGAAGTGTGG - Intronic
1126908828 15:53397600-53397622 CACAGCTCCTACATGAAGGTTGG + Intergenic
1129933975 15:79433783-79433805 GCTAGCTTCCACCTGCAGGGCGG - Intronic
1130981648 15:88815989-88816011 GACAGCTGCCACCAGAAGCCAGG - Intronic
1131068460 15:89449057-89449079 AACACCTCCCAGCTGAAAGGAGG + Intergenic
1132805734 16:1774255-1774277 CACAGCTGCCTCCTGAAGTGTGG + Exonic
1133582547 16:7159959-7159981 GACAACTCCCCCCTCAAGGAAGG - Intronic
1133611447 16:7437301-7437323 GGCAGCTCCCACTTTGAGGGTGG + Intronic
1136396276 16:29994168-29994190 GACAGGACCCAGCTTAAGGGTGG - Exonic
1141660960 16:85441172-85441194 GACAGCCCCCACCACAAAGGAGG - Intergenic
1142206043 16:88783867-88783889 GCGAGCTCCCACCTGGAGCGAGG + Intronic
1142591546 17:1008342-1008364 CACAGCTCCTGCCTGGAGGGTGG - Intronic
1143275240 17:5705444-5705466 GCTAGCTCCCATCTGGAGGGAGG + Intergenic
1149211761 17:54311553-54311575 GACATCTGCCAGCTTAAGGGAGG + Intergenic
1157701116 18:49762043-49762065 GGCAGCCCCCATCTGAAGGCAGG + Intergenic
1157878025 18:51291796-51291818 GACACATCTGACCTGAAGGGAGG - Intergenic
1158309033 18:56139208-56139230 GGCAGATCTCAACTGAAGGGAGG + Intergenic
1160148881 18:76384609-76384631 GCCAGGTCCCAACTGTAGGGGGG - Intronic
1160494639 18:79365687-79365709 GACAGCTCCCGCGTGATGGAAGG + Intronic
1161727675 19:5939661-5939683 CACCTCTCCCACCTGAGGGGTGG + Intronic
1161951697 19:7471187-7471209 GCCAGCCCCCACCTGGAAGGTGG - Exonic
1163612842 19:18310016-18310038 GACAGATCCTGCCTGCAGGGTGG - Intronic
1166828074 19:45621626-45621648 TACGGTTCCCACCTGCAGGGTGG + Exonic
926006308 2:9375900-9375922 GACAGCTCCCCCAGGAAAGGAGG - Intronic
927458144 2:23275212-23275234 AACAGCTGACACATGAAGGGGGG - Intergenic
937246519 2:120497454-120497476 TACAGCTGCCATGTGAAGGGTGG - Intergenic
938778172 2:134560106-134560128 GACAGCCCTAACCTGAAGGAGGG - Intronic
938981636 2:136532664-136532686 CTCAGCTCCCACCTGAGGGAGGG - Intergenic
943799931 2:192045155-192045177 TACAGCTACCACCTGAAAGTGGG + Intronic
1169316014 20:4591940-4591962 GCCAGCTCTGACCTGAAGGCCGG + Intergenic
1171212101 20:23324991-23325013 GACAGCTCCTACCTTTTGGGTGG + Intergenic
1172630515 20:36375200-36375222 ACCAGCTCCCACCTGCAGGGTGG - Intronic
1173656956 20:44705998-44706020 GGCAGCTCTGACCTGAAGAGAGG - Intergenic
1173873586 20:46356527-46356549 GACAGCTTCAGCCTGAAGGGAGG + Intronic
1174589295 20:51632485-51632507 GACAGCCCCCACCTGAGGAAGGG - Intronic
1175986223 20:62765331-62765353 GACAGCCCCCAGCTCCAGGGAGG - Intergenic
1178011701 21:28294741-28294763 GACAGCTGGTACCTGAAGTGAGG - Intergenic
1178305217 21:31485656-31485678 GACAGCACACTCCTGAAGGGAGG + Intronic
1179834106 21:44017691-44017713 GGCACCTCTCACCTGAAGGTCGG + Intronic
1181116083 22:20633217-20633239 GACAGCTCCATCCAGAAAGGAGG - Intergenic
1182757346 22:32690684-32690706 CACAGCTCCCACCTGGTGGAGGG - Intronic
1184335829 22:43852545-43852567 GGCAGTTCCCACCTGGATGGGGG - Intronic
1184657308 22:45948298-45948320 CACAGCTGGCACCTGGAGGGAGG + Intronic
949327123 3:2879276-2879298 GACAGCTACCACCAGAAGGTAGG + Intronic
954217533 3:49132857-49132879 GTCAGCTCCATCCTGAAGAGGGG + Exonic
960010934 3:112834131-112834153 CACAGCACCCTCCTAAAGGGTGG - Intronic
960579042 3:119258109-119258131 GAGAGCTCCACTCTGAAGGGGGG + Intergenic
962848468 3:139290308-139290330 GACAGCTCCAGCCTGTAGGGTGG + Intronic
967267646 3:187704801-187704823 GTCAGCTCCCACCCAAAGAGTGG - Intronic
969283311 4:6186138-6186160 GAAAGCTCCCAGCTGAAGTGAGG + Intronic
969312611 4:6362680-6362702 GACAGCCCCCACCTGGCGAGTGG + Intronic
970671732 4:18404508-18404530 GACAGCATTCACCTGAAGTGTGG - Intergenic
970981901 4:22108526-22108548 TACAGGTCCCATCTGAAAGGTGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
977727274 4:100311086-100311108 GGCAGCTAGCACCTTAAGGGTGG + Intergenic
978379417 4:108111436-108111458 CACAACTCCTGCCTGAAGGGAGG + Intronic
979946804 4:126843103-126843125 GGTAGCTCCTACCTGAAGGCTGG - Intergenic
981730007 4:147887253-147887275 GGCAGCTCCCACAGGCAGGGAGG - Intronic
982802563 4:159722794-159722816 GATAGCTCCTACCTGCAGGCAGG + Intergenic
983511547 4:168614358-168614380 AACAGCTCCCAGCTCAAGAGAGG + Intronic
990687373 5:58320962-58320984 GACAGCACCTACCTGGTGGGTGG + Intergenic
995457371 5:112366578-112366600 GACACAGCCCACCTGCAGGGAGG + Intronic
995852750 5:116562969-116562991 GACAGCACCCGCAGGAAGGGGGG + Intronic
996823287 5:127654058-127654080 GACCGTTCCCACCTGAAGGAGGG - Intronic
997512614 5:134463905-134463927 AACAACTCTCACCAGAAGGGTGG + Intergenic
997674472 5:135702431-135702453 GCCAGCACCCACCAGAAGGTGGG + Intergenic
998228113 5:140342346-140342368 GACAGCTGGCACCTGAAGGCAGG - Intronic
1000614228 5:163410182-163410204 CACAGCACCCAGCTGCAGGGAGG - Intergenic
1000955493 5:167537954-167537976 GTCAGCTTACACCTTAAGGGAGG + Intronic
1010032853 6:71288686-71288708 GGCAGCTCCCGCCTGTGGGGAGG + Intergenic
1014191768 6:118504474-118504496 GGAAGTTCCCTCCTGAAGGGTGG + Intronic
1017901145 6:158719519-158719541 GACACCTCGCTCCTGAAGTGTGG - Intronic
1019370382 7:660123-660145 GACAGTTCCCTCCTGCAGAGAGG + Intronic
1020101786 7:5397869-5397891 GACAGTTCCCTCCTTGAGGGCGG + Intronic
1021564209 7:22000781-22000803 CACAGATCCCACCTCAAGGCTGG + Intergenic
1024562260 7:50654359-50654381 GGCAGCGGCCACCTGAAGGCAGG - Intronic
1024643534 7:51352173-51352195 GACAACTTCCACTTGAAGGCTGG + Intergenic
1029272961 7:99387930-99387952 TACAGCTTCCACCTGGATGGTGG + Intronic
1033278970 7:139992395-139992417 GCCAGCTCCCAGCAGAGGGGAGG + Intronic
1036946661 8:13100613-13100635 GACGACTCCCACCCGAAGGACGG - Exonic
1037911566 8:22746735-22746757 GACAGCACCGATCTGGAGGGAGG - Intronic
1038532440 8:28329266-28329288 GACAGCTTCGACCTGGAGGTAGG + Exonic
1039007060 8:33051068-33051090 GACAGCTGCCAGCTGAAGTCTGG - Intergenic
1042765271 8:72314393-72314415 GACACCTGCCACCTGGAGGCAGG + Intergenic
1042950783 8:74198885-74198907 GACTGCTCCAGCCAGAAGGGAGG + Intergenic
1044149169 8:88752363-88752385 GGTAGCTCCTACCTGAAGGCAGG + Intergenic
1047599165 8:126409136-126409158 GACAGCTGTCACCTGGAGAGGGG - Intergenic
1047808210 8:128380557-128380579 AACATCTCCCATCTGAAGGGAGG + Intergenic
1050290934 9:4153949-4153971 GACAGCAGTCATCTGAAGGGTGG + Intronic
1056575893 9:87856057-87856079 GGAGGCTCCCATCTGAAGGGAGG + Intergenic
1056819547 9:89828661-89828683 CACAGCTCACACCTGAAGCTGGG - Intergenic
1059431304 9:114252064-114252086 GACAGCTCCAGCCAGAAGGTAGG - Intronic
1060224754 9:121784005-121784027 CAGAGGCCCCACCTGAAGGGTGG + Exonic
1060751528 9:126172876-126172898 CACAGCCCACACCTAAAGGGTGG + Intergenic
1061371533 9:130200477-130200499 GGCAGCTCTCAGCAGAAGGGTGG - Intronic
1062104111 9:134743472-134743494 GGCAGGTCCCACCTGCTGGGGGG + Intronic
1062671111 9:137709931-137709953 GACAGCTCCCACTTGCAGTCTGG + Intronic
1188313295 X:28643814-28643836 GACAGCTGGCAGCTGAAGAGAGG - Intronic
1188964850 X:36538009-36538031 GACAGCTCCAAATTGAAGAGGGG + Intergenic
1189326918 X:40118196-40118218 GAAAGCTCACACCTGAGGGGAGG - Intronic
1189335692 X:40169660-40169682 GCCAGCTCCGACCAGTAGGGGGG - Intronic
1194726028 X:97398507-97398529 GATACCTCCCTCCTCAAGGGTGG + Intronic
1195200171 X:102541962-102541984 GACAGAACCCACCTCCAGGGAGG - Intergenic
1198889562 X:141377857-141377879 CACTGCTCCACCCTGAAGGGAGG + Intergenic
1198927624 X:141816162-141816184 GAAAGGTCCCACCTGTAGAGAGG + Intergenic
1200110485 X:153738257-153738279 GACTGTCCCCTCCTGAAGGGTGG - Intronic
1200980779 Y:9261544-9261566 GACAGCTCCAGAATGAAGGGTGG + Intergenic
1201421467 Y:13804444-13804466 CAGAGCTCCCACATGAAGGGAGG - Intergenic
1201621419 Y:15962869-15962891 CACATCTCCCTCCTGAATGGTGG - Intergenic