ID: 1096568215

View in Genome Browser
Species Human (GRCh38)
Location 12:52498827-52498849
Sequence GTGTTTGACCAGAAGGCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096568215_1096568220 1 Left 1096568215 12:52498827-52498849 CCATCGGCCTTCTGGTCAAACAC No data
Right 1096568220 12:52498851-52498873 CTTTATTTCAGGAAAATATCTGG No data
1096568215_1096568223 25 Left 1096568215 12:52498827-52498849 CCATCGGCCTTCTGGTCAAACAC No data
Right 1096568223 12:52498875-52498897 TAATTCAGGAAAATATTTCAGGG No data
1096568215_1096568222 24 Left 1096568215 12:52498827-52498849 CCATCGGCCTTCTGGTCAAACAC No data
Right 1096568222 12:52498874-52498896 TTAATTCAGGAAAATATTTCAGG No data
1096568215_1096568217 -10 Left 1096568215 12:52498827-52498849 CCATCGGCCTTCTGGTCAAACAC No data
Right 1096568217 12:52498840-52498862 GGTCAAACACCCTTTATTTCAGG No data
1096568215_1096568221 11 Left 1096568215 12:52498827-52498849 CCATCGGCCTTCTGGTCAAACAC No data
Right 1096568221 12:52498861-52498883 GGAAAATATCTGGTTAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096568215 Original CRISPR GTGTTTGACCAGAAGGCCGA TGG (reversed) Intergenic
No off target data available for this crispr