ID: 1096569476

View in Genome Browser
Species Human (GRCh38)
Location 12:52513227-52513249
Sequence GATCCTATTAAATTTAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 9, 3: 25, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096569471_1096569476 11 Left 1096569471 12:52513193-52513215 CCATACTGAAGCTCAAATAATAC 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1096569476 12:52513227-52513249 GATCCTATTAAATTTAAACAAGG 0: 1
1: 0
2: 9
3: 25
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096569476 Original CRISPR GATCCTATTAAATTTAAACA AGG Intergenic
900805590 1:4765648-4765670 GATGCTATTTCTTTTAAACATGG + Intronic
901623817 1:10611535-10611557 GTTTCTTTTAAAGTTAAACATGG - Intronic
903114040 1:21163445-21163467 GATGCCATTAAAATTATACATGG + Intronic
907940037 1:59078669-59078691 GATCCTATGAAATTAAGAAAAGG + Intergenic
907964145 1:59312907-59312929 TATCCTTTTAAATTTAAAGTTGG - Intronic
908462739 1:64361683-64361705 GATCCTAAAAAATTTAAACATGG + Intergenic
908613650 1:65892384-65892406 GATCCTGATCTATTTAAACAAGG - Intronic
910328807 1:86044664-86044686 GAGTCTATTGAATTTAAAAAAGG - Intronic
911430663 1:97782596-97782618 GAACGTTTTAAATCTAAACAGGG - Intronic
915383059 1:155461263-155461285 GATACTACTTAATTGAAACAAGG - Intronic
917223741 1:172759667-172759689 GATCACAGTAAATTTAAGCAAGG - Intergenic
918269652 1:182885667-182885689 CATCCTCTTTAATATAAACAAGG + Intronic
918419213 1:184345846-184345868 GGTCATATTAAAATTAAGCAAGG + Intergenic
919285120 1:195548334-195548356 AATCTTATTAAATTTAAGAATGG + Intergenic
919291069 1:195631529-195631551 GTTTCTAGTAAATTTAACCAAGG + Intergenic
919681503 1:200439969-200439991 GATCCAATTAAAATTAAAGAAGG - Intergenic
1064698344 10:17990404-17990426 GTTACTATTAAATTTTAAAAAGG - Intronic
1065052504 10:21810358-21810380 GATCCTCCTAAATTTAAACAAGG + Intronic
1068241942 10:54314096-54314118 AATCCTTTTAAATATAAAAAAGG - Intronic
1068349162 10:55821054-55821076 GATCTTACTAAATTTAAACATGG + Intergenic
1069016001 10:63429920-63429942 TATCCTAGTAATTGTAAACAGGG + Intronic
1069215909 10:65820728-65820750 GATCCTTTTAAATTTATTGAGGG + Intergenic
1072933489 10:99689172-99689194 AATTCTATTAAATTTAAAAATGG - Intronic
1073530476 10:104227044-104227066 GATCCAATTCCATTTAAAAATGG - Intronic
1073996906 10:109325772-109325794 CATCTCATTAACTTTAAACAAGG + Intergenic
1074595672 10:114864477-114864499 TATCCTGTTTAATGTAAACAAGG - Exonic
1075904415 10:126068523-126068545 CATCCTATTGACTTTAAACAAGG + Intronic
1079569174 11:21921558-21921580 GATCCTATTGAAATTAAAAATGG - Intergenic
1079967535 11:26996809-26996831 GGTCTTCTTAAATTTAAACACGG + Intergenic
1080460017 11:32446191-32446213 TATCACATTAAATTTAAAAATGG + Intergenic
1080631686 11:34083203-34083225 GATCCTATTAAACATCCACAGGG - Intronic
1081056954 11:38421527-38421549 AATGCTCTTCAATTTAAACATGG + Intergenic
1081195866 11:40159958-40159980 GATTTTATGAAAATTAAACAGGG - Intronic
1081302579 11:41470591-41470613 AATACTAGTAATTTTAAACAGGG + Intergenic
1084426609 11:69087475-69087497 GATCCTGTTGGATGTAAACAAGG + Intronic
1085478214 11:76801129-76801151 AATCCTAATAACTTTGAACAAGG - Intergenic
1087472281 11:98591511-98591533 TATCCAATTAAGTTTAAAAATGG + Intergenic
1087512297 11:99112906-99112928 AATCCTATTCAAATTAAAAAGGG - Intronic
1087683923 11:101242307-101242329 GATCCCACTAAATTTAAACAAGG - Intergenic
1087689514 11:101303561-101303583 AATCCTATCAAATTTATAAAAGG - Intergenic
1091609174 12:1988830-1988852 GATCCTATGAATGTTAATCAAGG + Intronic
1092508241 12:9126031-9126053 GAACTTATAAAATATAAACATGG - Intergenic
1093257455 12:16887359-16887381 CATCCTATAAAATTGACACAAGG - Intergenic
1093423589 12:19002138-19002160 GATCCTATTCAATATATGCATGG + Intergenic
1093783651 12:23167353-23167375 GAAACTTTCAAATTTAAACAAGG + Intergenic
1093886822 12:24470842-24470864 GTTACTATGAAGTTTAAACATGG + Intergenic
1093972508 12:25387870-25387892 GATGATATTAAAGTAAAACATGG + Intergenic
1095880827 12:47134461-47134483 GAAAATATTAACTTTAAACAGGG + Intronic
1096569476 12:52513227-52513249 GATCCTATTAAATTTAAACAAGG + Intergenic
1097393395 12:59043231-59043253 GATAATATTAATATTAAACAGGG - Intergenic
1097589431 12:61556081-61556103 GATGTTATTTCATTTAAACATGG + Intergenic
1097626181 12:62003184-62003206 GATCCTTTTAAATGTAAATATGG + Intronic
1099422325 12:82476772-82476794 GGTCCTATTAAATTTTATTATGG + Intronic
1099466250 12:82991570-82991592 GGTCCAACTATATTTAAACATGG - Intronic
1100044134 12:90357622-90357644 GATCCAATTATATTTCTACATGG + Intergenic
1100588068 12:95997856-95997878 GTTTCTTTTAATTTTAAACAGGG - Intergenic
1108227161 13:48302015-48302037 GAGCCTGATAAATTGAAACAGGG - Intergenic
1109895772 13:68687211-68687233 GATGGTATTAAAATTAAATATGG + Intergenic
1112478946 13:99756259-99756281 AATCCTATTACATTTAGGCAGGG - Intronic
1113096623 13:106672052-106672074 GATCCTCCAAAATTCAAACAAGG + Intergenic
1115779062 14:36749481-36749503 GCTCCTATTAAAATAAAAAATGG + Intronic
1116062816 14:39945549-39945571 GATCATATCATATGTAAACAAGG + Intergenic
1116068336 14:40010984-40011006 TTTCCTATTAACCTTAAACAGGG - Intergenic
1116327329 14:43547165-43547187 TATCTTATTAAATTTAATCTAGG - Intergenic
1116433767 14:44874780-44874802 GATCCCACTATAGTTAAACAAGG + Intergenic
1117427126 14:55612009-55612031 GATCCTATAAAACCTAAATAGGG - Exonic
1118077860 14:62320866-62320888 GATCCTATTTAATGTTAACCGGG - Intergenic
1118170256 14:63381692-63381714 GGTCCCATAAAATTTTAACAGGG + Intronic
1120080890 14:80215051-80215073 GAACATATGAAATCTAAACAAGG - Intronic
1125261338 15:37828732-37828754 GATCAAGTTACATTTAAACAAGG + Intergenic
1126207124 15:46058455-46058477 GATCCTAGTACATTTAAACAAGG + Intergenic
1128097492 15:64968872-64968894 AATCAAAATAAATTTAAACAAGG - Intronic
1131342732 15:91617855-91617877 CATAATATTGAATTTAAACAAGG + Intergenic
1133446151 16:5862788-5862810 GACCCTATAAAAGTTATACAGGG + Intergenic
1135458035 16:22615886-22615908 GATCCCACTAAATTTAAACAAGG - Intergenic
1135747466 16:25029482-25029504 AATCCCACTAAATTGAAACATGG - Intergenic
1135752194 16:25066634-25066656 AATCCCATTAAATTGAAACATGG + Intergenic
1136638597 16:31542429-31542451 GTTCCTATTATATTGAAACATGG + Intergenic
1139080609 16:63514642-63514664 GATGATATTAAATATAAATAGGG - Intergenic
1139091071 16:63648231-63648253 GATCCTGTAAAATTGGAACATGG + Intergenic
1140289522 16:73639622-73639644 AATGCCATTAAATTTATACAGGG - Intergenic
1143909845 17:10238791-10238813 GATCCTATTTTATGTTAACATGG + Intergenic
1145291489 17:21550071-21550093 AATCCCATTTAATTTAAAGATGG - Intronic
1145388592 17:22436956-22436978 AATCCCATTTAATTTAAAGATGG + Intergenic
1146071115 17:29682773-29682795 AATCCTAATGAATGTAAACAAGG + Intronic
1146131366 17:30279149-30279171 GATCCTATTAATTCTAAATCTGG + Intronic
1148263625 17:46206671-46206693 ATTCTAATTAAATTTAAACACGG + Intronic
1148370191 17:47093731-47093753 ATTCTAATTAAATTTAAACATGG + Intergenic
1149171211 17:53813734-53813756 CAACCTATTTAAGTTAAACAGGG - Intergenic
1150542980 17:66122744-66122766 GATCCAATTAAATTCAGGCAGGG + Intronic
1153495438 18:5693607-5693629 CATATTATTAAATTAAAACATGG + Intergenic
1153500955 18:5749568-5749590 GCTCCTATTCCATCTAAACATGG + Intergenic
1153931420 18:9882967-9882989 GATCCTGTTACATTTATACTTGG - Intergenic
1155228495 18:23751415-23751437 GCTCCTATTACAGTTTAACATGG + Intronic
1157034164 18:43951523-43951545 GATCCTTTAAAATGTAAGCAGGG - Intergenic
1157927784 18:51784878-51784900 GATCAGATAGAATTTAAACAAGG - Intergenic
1158771799 18:60527260-60527282 GATTCTATAAAATTCAAAAAAGG - Intergenic
1159378326 18:67623671-67623693 GAACCTATTAAATTTTAATTTGG - Intergenic
1160576670 18:79858615-79858637 GTTCCTCAAAAATTTAAACATGG - Intergenic
1161179496 19:2870089-2870111 GATCCAATTTAAATTAATCATGG - Intronic
1162224267 19:9206548-9206570 GATGCTATTGACTTTAAGCAAGG - Intergenic
1162665673 19:12209665-12209687 GATACCATTGAATTTAAACATGG - Intergenic
1162692199 19:12442150-12442172 GATCATATTATATGCAAACAAGG + Intronic
1162711012 19:12594854-12594876 GATCCCACTAAATGTAAGCAAGG - Intronic
1162841402 19:13359113-13359135 GATCCTGGTAACTTAAAACATGG + Intronic
1166810375 19:45510630-45510652 GTGCCTATTAAACTCAAACAGGG + Intronic
1167139763 19:47641921-47641943 GATTAAATTAAATTTAACCAAGG - Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926306538 2:11641051-11641073 GATCCTATTAAAATAATATAGGG + Exonic
926418182 2:12671287-12671309 GGTGTTATTAAATTTGAACAAGG + Intergenic
926622584 2:15060432-15060454 GATCATATTTTATTGAAACAAGG + Intergenic
928679422 2:33684635-33684657 GATCATATTATCTTCAAACAAGG + Intergenic
930681126 2:54257444-54257466 TGTCCTATTAAAGTTAGACAAGG - Intronic
931897815 2:66752586-66752608 GAAGATATAAAATTTAAACAAGG - Intergenic
931933016 2:67162071-67162093 GATCCTGTTAATTATAAACATGG + Intergenic
933393955 2:81708111-81708133 TATCCTATTAGATGTAAACAAGG + Intergenic
935375596 2:102393581-102393603 TATCCTATTAGATTTTAATAGGG + Intronic
937015016 2:118597131-118597153 AGTCCTATTAAATTGATACAAGG - Intergenic
937881906 2:126874511-126874533 AATTGTAATAAATTTAAACAAGG + Intergenic
940697683 2:157000247-157000269 GCTCTTATGAAATTTGAACATGG + Intergenic
943735319 2:191347764-191347786 CCTCCTATAAAATTAAAACATGG - Intronic
944570527 2:201040208-201040230 GAGCCTATTAAGTATAAACATGG + Intronic
945092475 2:206188251-206188273 GATCCTCTTTATTTTAAACCTGG - Intronic
945965010 2:216177362-216177384 GATCCTAGTGAATTTTTACAGGG + Intronic
947249603 2:228086957-228086979 GATCCAATTAAATTTCAGCAAGG - Intronic
1169180461 20:3561592-3561614 GATACAATGAAATTTAACCAAGG - Intronic
1169256541 20:4104298-4104320 GATCCCACTAAATTAAGACAAGG - Intergenic
1172019492 20:31903315-31903337 GAGACAACTAAATTTAAACATGG - Intronic
1173658693 20:44718432-44718454 GATCCTACTAAACTCAAACTTGG + Intronic
1173765771 20:45608186-45608208 GATGCTATTAATTTTAGAAATGG - Intronic
1174372586 20:50102695-50102717 GATCCTCTTAAAGGTAAACTAGG + Intronic
1176899696 21:14425008-14425030 GATCCTATCATCTATAAACAAGG - Intergenic
1177331567 21:19671787-19671809 GATCCTATTATCTACAAACAAGG - Intergenic
1177487726 21:21780638-21780660 GATCGTATTAATTGCAAACAAGG + Intergenic
1177807572 21:25889190-25889212 GAGGTTATTAAAGTTAAACAAGG + Intronic
1178464942 21:32839461-32839483 GAGATTATTAAATGTAAACATGG - Intergenic
1178731113 21:35103534-35103556 GATCCTATTTCTTTTGAACATGG + Intronic
1178963333 21:37089402-37089424 GGTACTATTAAATTTAGAAAGGG + Intronic
1179000062 21:37449399-37449421 GACACTATTAAATTTAAAATAGG - Intronic
1185163836 22:49245532-49245554 GATGATATTTACTTTAAACATGG - Intergenic
950694333 3:14686382-14686404 GTTCCTCTGAAATTTAAAAATGG - Intronic
955910460 3:63854245-63854267 GTTCTTTTTAAATTTAAAGATGG + Intronic
957205281 3:77190180-77190202 GATCCTATCTATATTAAACATGG + Intronic
957755072 3:84474503-84474525 GATCACATTAAATTAAAAAAGGG + Intergenic
957817756 3:85324422-85324444 ACTCCTATTGAATTTTAACAAGG + Intronic
958104548 3:89055263-89055285 GATCCCACTATATTTAAACAAGG - Intergenic
960110744 3:113842226-113842248 GTTCCCACTAAATTTAAACAAGG - Intronic
960482484 3:118209974-118209996 TATACGATTAAATTTAAAAATGG - Intergenic
961623732 3:128244607-128244629 GTTCCTTTTCATTTTAAACAGGG - Intronic
962188085 3:133281235-133281257 GATCTGACTATATTTAAACATGG - Intronic
963098479 3:141573177-141573199 GATCCTATTAAATTGAAAGAGGG + Exonic
964360237 3:155888307-155888329 GATACTTTTAAAATTACACAAGG - Intronic
965759051 3:172055433-172055455 TATTATATTCAATTTAAACAGGG + Intronic
965853650 3:173062496-173062518 TATCCCATTAAATATATACACGG + Intronic
967468815 3:189839155-189839177 AATCCTATTATATTTACACCTGG + Intronic
967670627 3:192230763-192230785 AATCCTATTAAAATTATACATGG - Intronic
969404977 4:6985394-6985416 GATCATTTTAATTTTAAAAAAGG - Intronic
970673820 4:18425458-18425480 GATGCTATTAAATTCAAATTAGG - Intergenic
972188479 4:36561857-36561879 AATCCTATTAACTGTGAACAGGG - Intergenic
972578528 4:40374432-40374454 GATGCTGTTAAATGTAAACCAGG + Intergenic
973942472 4:55924546-55924568 GATCAGATTAAGTTTAAACCAGG + Intergenic
976600479 4:86934111-86934133 CATCATATTAAATTTAAGTAAGG + Intronic
976617992 4:87097597-87097619 GATCCTAATAGATTTACAGAAGG + Intronic
977186127 4:93939409-93939431 GAGCCTCTTAAATATAAACTTGG + Intergenic
977734405 4:100395697-100395719 GATACTCATAAATTTAAATATGG + Exonic
977785337 4:101026943-101026965 GGTCCTATTCAATTAAAACATGG + Intronic
978584649 4:110264128-110264150 GAACCTACTAAATGAAAACACGG - Intergenic
978935330 4:114367770-114367792 AATACTATTAAATTCAAGCAAGG + Intergenic
979028702 4:115610822-115610844 GATTCTATTAAATAACAACAGGG + Intergenic
979890945 4:126093616-126093638 GATCTTTTAAAATTTAAACAAGG - Intergenic
980074578 4:128281067-128281089 CATGTTAGTAAATTTAAACAAGG + Intronic
980271175 4:130585694-130585716 GATCCTCTGAAAATTAAAAATGG - Intergenic
982949310 4:161669230-161669252 GATTGCATTAAATTTAAAGATGG - Intronic
983296860 4:165877210-165877232 AATCCTATCAAATTAACACAAGG - Intronic
983319391 4:166176576-166176598 GATTCAATTAACTTAAAACATGG + Intergenic
986538486 5:8817336-8817358 GATTATATTACATTTTAACATGG - Intergenic
986823929 5:11499998-11500020 AATCCTATTTAATATAAAAAGGG + Intronic
988075224 5:26343734-26343756 GATCATTTTAAATGTCAACAGGG - Intergenic
988942732 5:36162415-36162437 GATGTTATTAAGTTTGAACATGG - Intronic
990959716 5:61381464-61381486 GACTCTATTGAATTTAAATAAGG + Intronic
992272230 5:75077009-75077031 GATCCTTTTATTTTTAAAAAAGG - Intronic
992517407 5:77509003-77509025 GATCCAATTAAATTCAGGCAGGG + Intronic
992575949 5:78112416-78112438 AATTCTTTTAAATTCAAACATGG + Intronic
992956447 5:81914288-81914310 GATCATATTAAATAAAAATATGG - Intergenic
993645143 5:90452691-90452713 AATCCTATTAAAATTAAAATGGG + Intergenic
994001135 5:94780835-94780857 AATCCAGTAAAATTTAAACAGGG + Intronic
994326422 5:98451500-98451522 AATCCTATTATATGTAAACAGGG - Intergenic
1000206969 5:159070927-159070949 GAAACTATGAAATTCAAACACGG + Intronic
1001125138 5:169012534-169012556 GATTCTAGTAAATTTTAACGAGG - Intronic
1001468974 5:171995021-171995043 GAAAGTATTAAATTAAAACAAGG + Intronic
1001946351 5:175781520-175781542 GATCCTATTACATTAAAGAAAGG + Intergenic
1002560554 5:180079157-180079179 GATCCCATTCAAATAAAACAGGG - Intergenic
1003197971 6:3931764-3931786 AATCCTATTAAATTTAATCATGG - Intergenic
1004091271 6:12504275-12504297 AATCCAATTAAAGTTAAACGGGG - Intergenic
1009372669 6:62926611-62926633 TATCATAATAAATTTAAAAAAGG + Intergenic
1010121868 6:72385822-72385844 GACCCTTATGAATTTAAACAAGG + Intronic
1011404570 6:87004802-87004824 GATCATATTATCTATAAACAAGG - Intronic
1012892754 6:104915518-104915540 GAAACTATTAAAATAAAACATGG + Intergenic
1013388382 6:109656295-109656317 TATCCCATTATATGTAAACATGG - Intronic
1014543097 6:122699935-122699957 GATCTTCCTAAATTTAAACATGG - Intronic
1015374743 6:132497333-132497355 GATTCTATTAGATTAAAAAAAGG + Intronic
1015649081 6:135434100-135434122 GAACATATTAATTTTAAATATGG + Intronic
1015821405 6:137265004-137265026 GCTCCTCATAAAGTTAAACATGG + Intergenic
1016999484 6:149986102-149986124 GATACTTTTACATTTAAAAATGG - Intergenic
1017437425 6:154429527-154429549 TATCAGATTAAGTTTAAACAGGG - Intronic
1019364394 7:624686-624708 AGGCCTATTAAATTTAAAAATGG + Intronic
1020717706 7:11697175-11697197 TAATCAATTAAATTTAAACATGG - Intronic
1021126517 7:16856523-16856545 CATCCAGTTAAATTTAAATAAGG - Intergenic
1021210955 7:17851784-17851806 GATCCCATTAAATATAAAAATGG + Intronic
1021570567 7:22060637-22060659 GATCATATAAAATATAAACAAGG + Intergenic
1021660289 7:22913210-22913232 GATCCAATTAAACTTAGGCAGGG - Intergenic
1023309105 7:38865243-38865265 AATCCTCTTAAATAGAAACATGG + Intronic
1023365161 7:39456788-39456810 ATTCTTATGAAATTTAAACAGGG - Intronic
1023727631 7:43160940-43160962 GATGTTATAAAATTTAAATAAGG - Intronic
1026344263 7:69460794-69460816 GGTCCTGTCAATTTTAAACAAGG + Intergenic
1026671289 7:72392803-72392825 GGTCTTTTTTAATTTAAACAGGG - Intronic
1027461711 7:78462558-78462580 CATTCTATTAAATCTAAAGAAGG + Intronic
1027820921 7:83043499-83043521 CATCCTCTTAAATTCCAACAAGG + Intronic
1028276713 7:88866119-88866141 GATCTTATTTAATTTTAACCTGG + Intronic
1028573702 7:92321381-92321403 GGTCCTATGAAAAATAAACAGGG - Intronic
1031756802 7:125654460-125654482 GATCAAATTCAATTTATACAGGG - Intergenic
1033542998 7:142374272-142374294 GATACTATTAATTATAAACTTGG - Intergenic
1033787131 7:144746038-144746060 CATGCTATTGAATGTAAACAAGG + Intronic
1034388117 7:150757830-150757852 AAACCTATTAATTTTAAAAAGGG + Intergenic
1043588704 8:81800317-81800339 CATCCTATAAAAATGAAACAAGG + Exonic
1043678109 8:82986903-82986925 CATCATATGAAATTTAAAAATGG - Intergenic
1043836170 8:85049543-85049565 AATGCTACTATATTTAAACATGG + Intergenic
1044446788 8:92286998-92287020 GACCCTTTTAAACTTAAATATGG - Intergenic
1046313122 8:112464816-112464838 GATCCCACTAAATTTCAATAAGG + Intronic
1046342027 8:112871063-112871085 GATCCTATCAAATGTTACCATGG - Intronic
1046859327 8:119072352-119072374 GAAATAATTAAATTTAAACATGG - Intronic
1051355534 9:16236689-16236711 GATTCAATTAATTTTTAACATGG - Intronic
1051901324 9:22044950-22044972 GATCATATGAAATGTATACATGG - Intergenic
1053335369 9:37265462-37265484 GAAACTATTAAATAAAAACATGG - Intronic
1055327986 9:75152062-75152084 AATCATATTAACTTTGAACAAGG + Intergenic
1056200974 9:84276171-84276193 GATTTTATGAAATCTAAACATGG + Exonic
1059900245 9:118916763-118916785 GATCATATTATCTGTAAACAAGG + Intergenic
1186296287 X:8152492-8152514 TATCTAAGTAAATTTAAACAGGG + Intergenic
1186802670 X:13109338-13109360 GATCCTCAAAAAGTTAAACATGG - Intergenic
1189747252 X:44181870-44181892 AATCCTACTAAAGTTTAACAGGG - Intronic
1190574231 X:51816941-51816963 GATCCCACTATATTTAATCAAGG + Intronic
1190594056 X:52035422-52035444 GATCATATTAAAAATTAACATGG - Intergenic
1192975834 X:76284118-76284140 TATCATATTATATGTAAACAAGG + Intergenic
1193259981 X:79393856-79393878 GATTCTATGAATATTAAACAGGG + Intergenic
1193424345 X:81322953-81322975 GATCATATTAACTGCAAACAAGG + Intergenic
1194584650 X:95717510-95717532 GATGCCATTAAATTAAAACATGG + Intergenic
1194687679 X:96943605-96943627 GATCTTATTAATCTTAAACATGG + Intronic
1195277369 X:103294806-103294828 GATCCCACTAAATTTAAACATGG - Intergenic
1195685587 X:107582059-107582081 GTTCCTCTAAAAGTTAAACATGG - Intronic
1196459540 X:115916148-115916170 AATACTATTAAATCAAAACAGGG + Intergenic
1197273219 X:124448770-124448792 GATCAAATTACATTTAAGCATGG + Intronic
1197466471 X:126810134-126810156 GATCATATTATCTGTAAACAAGG + Intergenic
1198801622 X:140453603-140453625 GATCCAATTACATTTAAGCAGGG + Intergenic
1198934672 X:141894472-141894494 GATTCTATTAACTTCACACACGG + Intronic
1199921824 X:152414187-152414209 GATCCTATTAAAAATAAAGGTGG - Intronic