ID: 1096570052

View in Genome Browser
Species Human (GRCh38)
Location 12:52517507-52517529
Sequence CCATGACGACACTAAGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096570052_1096570057 -3 Left 1096570052 12:52517507-52517529 CCCCATTCTTAGTGTCGTCATGG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1096570057 12:52517527-52517549 TGGCCTAGAATCCTAGACATGGG 0: 1
1: 0
2: 3
3: 7
4: 96
1096570052_1096570060 15 Left 1096570052 12:52517507-52517529 CCCCATTCTTAGTGTCGTCATGG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1096570060 12:52517545-52517567 ATGGGTGTGTCCCCTCACTCAGG 0: 1
1: 0
2: 0
3: 21
4: 142
1096570052_1096570056 -4 Left 1096570052 12:52517507-52517529 CCCCATTCTTAGTGTCGTCATGG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1096570056 12:52517526-52517548 ATGGCCTAGAATCCTAGACATGG 0: 1
1: 2
2: 0
3: 12
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096570052 Original CRISPR CCATGACGACACTAAGAATG GGG (reversed) Intronic
903455059 1:23481863-23481885 CCATGAAATCCCTAAGAATGTGG + Intronic
910110988 1:83683176-83683198 ACATGACCACATTCAGAATGAGG - Intergenic
911094204 1:94042637-94042659 CAATGACTACACTCAGAAGGGGG - Intronic
913606005 1:120466621-120466643 CACTGAAGACACAAAGAATGAGG - Intergenic
913644192 1:120840993-120841015 CACTGAAGACACAAAGAATGAGG - Intronic
914082553 1:144422591-144422613 CACTGAAGACACAAAGAATGAGG + Exonic
914177451 1:145291104-145291126 CACTGAAGACACAAAGAATGAGG + Exonic
914210424 1:145573543-145573565 CACTGAAGACACAAAGAATGAGG + Intergenic
914269347 1:146065896-146065918 CACTGAAGACACAAAGAATGAGG + Exonic
914485231 1:148103247-148103269 CACTGAAGACACAAAGAATGAGG + Exonic
914532180 1:148532583-148532605 CACTGAAGACACAAAGAATGAGG + Exonic
914585196 1:149055234-149055256 CACTGAAGACACGAAGAATGAGG + Exonic
914636215 1:149555138-149555160 CACTGAAGACACAAAGAATGAGG - Intergenic
914861566 1:151390445-151390467 ACAAAACAACACTAAGAATGTGG - Intergenic
915135799 1:153730522-153730544 CAATGACGCCTCTAAGAATCAGG - Intronic
919527608 1:198673189-198673211 CCATGATTACCCTAAGAATAGGG + Intronic
919527882 1:198677560-198677582 CCATGATTACCCTAAGAATAGGG + Intronic
1065241939 10:23714454-23714476 CCAGGGCGACACTAAGACTTTGG + Intronic
1080948757 11:37004538-37004560 CCATGACATCAGTAAGATTGAGG - Intergenic
1083214437 11:61209629-61209651 CCATGAGGACACTGAGCCTGAGG - Intronic
1083217321 11:61228458-61228480 CCATGAGGACACTGAGCCTGAGG - Intronic
1083220308 11:61248206-61248228 CCATGAGGACACTGAGCCTGAGG - Intronic
1089834174 11:121355663-121355685 CCATAAAAACACAAAGAATGGGG + Intergenic
1090990299 11:131811257-131811279 CTATGAGGACACAAAGGATGAGG - Intronic
1091156638 11:133380904-133380926 CCAAGACAACACCAAGAATAAGG + Intronic
1093686049 12:22055167-22055189 CCATGATGAAATTGAGAATGTGG + Exonic
1095871174 12:47029927-47029949 CCATGAAGAAACTAACCATGTGG - Intergenic
1096570052 12:52517507-52517529 CCATGACGACACTAAGAATGGGG - Intronic
1097395149 12:59064268-59064290 CCATGTTGACACAAAGAAAGAGG + Intergenic
1098468093 12:70811738-70811760 CCATGTCCACACTACCAATGAGG + Intronic
1098971491 12:76861770-76861792 AGATGACGACACTAAGAGTCGGG - Intronic
1099273685 12:80548084-80548106 ACATGAGGACAATAAGAATCAGG + Intronic
1100781976 12:98036603-98036625 CAATGAAGATACAAAGAATGTGG + Intergenic
1103064651 12:117887415-117887437 CCATCAAGAGACTAAGAATCAGG + Intronic
1104343500 12:127974300-127974322 ACATAACGACACTAAGAAGGGGG - Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1109300149 13:60582747-60582769 CCATGAAGACTCCAAGAATTAGG - Intergenic
1111938845 13:94587533-94587555 CCATGACAAAACTGACAATGAGG + Intronic
1113793195 13:113041506-113041528 CCATGACCACAGTCAGTATGGGG + Intronic
1113793207 13:113041547-113041569 CCATGACCACAGTCAGTATGGGG + Intronic
1115125702 14:29990202-29990224 CAATGGAGACACTAAGAATAAGG - Intronic
1115839571 14:37453197-37453219 CCTTGAAGACACAAAGAATATGG - Intronic
1116502912 14:45642405-45642427 ACATGACAACAATATGAATGGGG - Intergenic
1119391079 14:74291375-74291397 AGATGAGGACACTAAGAATCAGG + Intronic
1127904542 15:63366491-63366513 CCATTATGAGACTAAGAATCTGG - Intronic
1152533114 17:80932030-80932052 CCATGGTGACACTCAGCATGTGG - Intronic
1153861374 18:9212132-9212154 CCATGAGGACTGTAAGAGTGTGG + Intronic
1163777554 19:19227136-19227158 CCATGGCTACACTCAGAATGAGG + Intronic
928256070 2:29723662-29723684 CGATGACGAGAATAAGAATAGGG + Intronic
934212339 2:89992489-89992511 TCCTGATGACACTAAGAGTGTGG - Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
938765532 2:134458674-134458696 CGATGAGAAAACTAAGAATGAGG + Intronic
939281296 2:140068890-140068912 TCATGACGAGACTGAGAATTTGG + Intergenic
941297341 2:163756649-163756671 CCATAACAACACTAAGAATATGG + Intergenic
942714131 2:178871655-178871677 CCATGAAAACACTCAGGATGTGG + Intronic
1169895149 20:10496799-10496821 CCAGGAAGAAATTAAGAATGGGG + Intronic
1170517133 20:17142280-17142302 CCATGTAGCCACAAAGAATGTGG + Intergenic
1174305740 20:49613159-49613181 CTATCACGACACTAAGCATGAGG + Intergenic
1180902812 22:19386856-19386878 TAATGACTACACTTAGAATGGGG - Intronic
950381004 3:12614841-12614863 CTACTAAGACACTAAGAATGAGG + Intronic
956698415 3:71937919-71937941 CCATGATGACAACAAGAAGGGGG + Intergenic
957502810 3:81078644-81078666 CCATGACTACACAAATAAGGGGG + Intergenic
961053198 3:123764970-123764992 CTATGAGGACAGAAAGAATGAGG - Intronic
967189316 3:186972082-186972104 CCATGACAACCCTAAGAATTGGG + Intronic
970170372 4:13283430-13283452 CCATGACCACAGTAAGGAGGGGG + Intergenic
971163823 4:24161541-24161563 TCATGACAACCCCAAGAATGAGG - Intergenic
971340531 4:25764850-25764872 CTATGAGGACACTAACAATAAGG - Intronic
974913650 4:68152833-68152855 CCATTATGACAGTAAGAAGGGGG + Intergenic
983735587 4:171055371-171055393 CCATGCTGTCACTAAGAATCAGG + Intergenic
984060588 4:174984913-174984935 CCATGTCGAGACTGATAATGAGG - Intergenic
984401153 4:179266604-179266626 CCATGATGATAATAAAAATGAGG + Intergenic
987683485 5:21166666-21166688 CCAAGACCACACTATGAATTAGG - Intergenic
990718560 5:58667155-58667177 CACTGATGACACTAACAATGGGG + Intronic
992724280 5:79590948-79590970 ACTTGACAACAATAAGAATGGGG + Intergenic
995133178 5:108652217-108652239 CCATGATAAAACTAAGAATTTGG + Intergenic
997310853 5:132880957-132880979 CCTAGTCGACACTAAGAATGAGG - Exonic
1004338007 6:14782184-14782206 GCTTGAGAACACTAAGAATGTGG - Intergenic
1008187342 6:48410569-48410591 AGATGAAGACACTAAGAATCAGG + Intergenic
1010633123 6:78223655-78223677 CCATGACATCACTGAGAAAGTGG + Intergenic
1010943732 6:81950513-81950535 CCAGGAGAACAGTAAGAATGAGG + Intergenic
1013061725 6:106640629-106640651 CCATGAGGATAATAAAAATGAGG + Intronic
1013924558 6:115454467-115454489 CAATATTGACACTAAGAATGTGG - Intergenic
1015715946 6:136191929-136191951 CCAGGACAACACTCAGAAAGTGG - Exonic
1021739976 7:23677313-23677335 CCATTAAGACAATAAGAATCAGG + Intergenic
1023127080 7:36965186-36965208 CCATGAATACATTAAGAATGGGG - Intronic
1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG + Intronic
1033968860 7:147012265-147012287 CCATGACAAACCTTAGAATGAGG - Intronic
1037508079 8:19552635-19552657 ACATGACGACATTCAAAATGTGG + Intronic
1042748007 8:72128232-72128254 ACATGAACACACAAAGAATGAGG - Intergenic
1044697177 8:94935209-94935231 ACATGACAACACTAACAATAGGG + Intronic
1051028471 9:12644712-12644734 CCATGACAACACTATGGTTGCGG + Intergenic
1051452206 9:17209771-17209793 CCATGACTTCTATAAGAATGTGG + Intronic
1055926273 9:81513242-81513264 CCATGTTGACAAAAAGAATGAGG + Intergenic
1056109505 9:83380931-83380953 CCATGACGACCCTAAAAAGATGG + Intronic
1056725083 9:89107281-89107303 CCATGACTGCAGTAAGTATGTGG + Intronic
1187740738 X:22352845-22352867 CAATGAAGACACTGAGAATGTGG + Intergenic