ID: 1096571111

View in Genome Browser
Species Human (GRCh38)
Location 12:52523869-52523891
Sequence CTGAACAAGCGTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096571111_1096571119 28 Left 1096571111 12:52523869-52523891 CCTTCCACCTCACGCTTGTTCAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1096571119 12:52523920-52523942 TGTGAGTCACCCTATTCATTGGG 0: 1
1: 0
2: 1
3: 8
4: 66
1096571111_1096571116 -9 Left 1096571111 12:52523869-52523891 CCTTCCACCTCACGCTTGTTCAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1096571116 12:52523883-52523905 CTTGTTCAGCACAAAAAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1096571111_1096571118 27 Left 1096571111 12:52523869-52523891 CCTTCCACCTCACGCTTGTTCAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1096571118 12:52523919-52523941 GTGTGAGTCACCCTATTCATTGG 0: 1
1: 0
2: 1
3: 4
4: 74
1096571111_1096571117 5 Left 1096571111 12:52523869-52523891 CCTTCCACCTCACGCTTGTTCAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1096571117 12:52523897-52523919 AAAGTGGGGAGCAATAGTTGAGG 0: 1
1: 0
2: 1
3: 9
4: 167
1096571111_1096571115 -10 Left 1096571111 12:52523869-52523891 CCTTCCACCTCACGCTTGTTCAG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1096571115 12:52523882-52523904 GCTTGTTCAGCACAAAAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096571111 Original CRISPR CTGAACAAGCGTGAGGTGGA AGG (reversed) Intergenic
902984397 1:20146771-20146793 CTGTTCAAACATGAGGTGGAGGG + Intronic
903290278 1:22308537-22308559 CTGAAAAACCGTGAAGTGGGAGG + Intergenic
915718882 1:157969017-157969039 CTGAGCAAGCCTGAGGAGGCTGG + Intergenic
915984878 1:160454621-160454643 ATGAAGAAGAGTGAGGTAGACGG + Intergenic
918359505 1:183741367-183741389 CTGAGCAAGCCAGTGGTGGATGG + Intronic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
922677146 1:227560065-227560087 CAAAAAAAGCGCGAGGTGGAGGG - Intergenic
924814086 1:247427384-247427406 CTCATTAAGAGTGAGGTGGAAGG + Intronic
1065099071 10:22316207-22316229 CTGGACAAGCGAGAGCTGGACGG + Exonic
1070394498 10:76000469-76000491 CTGAACAATGGTGAGAGGGAAGG + Intronic
1072034038 10:91548291-91548313 CTGGACAAGCGTGAGGTAAATGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1080779592 11:35418737-35418759 TTGAAAATGCGAGAGGTGGAGGG - Intronic
1080822966 11:35824605-35824627 CTTAAGAAAGGTGAGGTGGAGGG - Intergenic
1083886763 11:65576872-65576894 CTGAAGAGGCGGGAGTTGGAGGG - Intronic
1084157618 11:67322968-67322990 ATGAACAGGGCTGAGGTGGAGGG - Intronic
1085251705 11:75148207-75148229 CAGGACAGGCCTGAGGTGGAGGG + Intronic
1086373382 11:86176685-86176707 CAGAACAACCCTGAGGTGGAGGG + Intergenic
1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG + Intronic
1088574153 11:111253418-111253440 CAGAACCATCGTGATGTGGATGG - Intergenic
1092171120 12:6374695-6374717 GGGAACAAGCGTGAGGAGCAGGG - Exonic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1112630908 13:101160402-101160424 CTGACCAAGCGTGGGGAGGAGGG + Intronic
1113430476 13:110245922-110245944 ATGAAAAAGCGTAAGGTGGTGGG - Intronic
1114479679 14:23024937-23024959 CTGCACAAGGCTGAGGGGGAAGG + Intronic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1119966941 14:78927355-78927377 GGGAACAAGCGTAAGGAGGAGGG + Intronic
1122405589 14:101498911-101498933 GTGAACAGGTGTGAGCTGGAAGG - Intergenic
1124613237 15:31223528-31223550 CTGACCAAGCGTGAGAAGGCGGG + Intergenic
1132027225 15:98413758-98413780 CTGAACAAAGGTGATGTGGATGG + Intergenic
1135405132 16:22192000-22192022 CACCACAAGCCTGAGGTGGATGG + Intergenic
1135801987 16:25506098-25506120 GTGAACATGTGTTAGGTGGAAGG - Intergenic
1136230508 16:28882929-28882951 CTGACCAAGCTTGGGGTGGGTGG - Intronic
1137348924 16:47693385-47693407 CTGAACAGGCGTCAGATCGATGG + Exonic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140315338 16:73891026-73891048 CTGAGCGGGGGTGAGGTGGAGGG - Intergenic
1141093747 16:81148272-81148294 CTGAACAATCAGGAGGTTGATGG + Intergenic
1144287240 17:13788610-13788632 GTTAACAAGGGTGAGGAGGAAGG - Intergenic
1146379547 17:32318762-32318784 CTGAACAAACCTGGGATGGAGGG + Intronic
1147570279 17:41566271-41566293 CTGGACAATCCTGAGGTAGAAGG + Intronic
1148344197 17:46892460-46892482 CTGAGCAGGAGTGAGTTGGATGG - Intergenic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1155840110 18:30632966-30632988 CTGAAAAAGAGAGAGGTGGCAGG + Intergenic
1157272697 18:46288692-46288714 CTGAGCAAAAGTGAGGTGAAGGG + Intergenic
1157277813 18:46324219-46324241 CTGAACAAGCGAGATGTGACAGG - Intergenic
1157331309 18:46705674-46705696 CTGAACAACCGCCAGGAGGAGGG - Intronic
1158838666 18:61359532-61359554 CTGAACAAGGGTGGGGAGCATGG + Intronic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
928120043 2:28577490-28577512 CTGAACAAGCCTGGCTTGGAAGG + Intronic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
929046073 2:37791883-37791905 CTGAAAAAGTGTGTGGTGGTTGG + Intergenic
929474491 2:42232236-42232258 CTGCACAAGTGGGAGGTGGTGGG + Intronic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948844132 2:240675151-240675173 CTGGACGAGCGTTTGGTGGAGGG - Intergenic
948849728 2:240699728-240699750 CTGGACGAGCGTTTGGTGGAGGG + Intergenic
1172130073 20:32649767-32649789 CTGAAGAAGGGTGAGGCTGAGGG - Intergenic
1174696582 20:52565604-52565626 CAGTACAAGGGTGAGGTGGCTGG + Intergenic
1179718770 21:43303710-43303732 CAGAGCGAGCGGGAGGTGGAAGG + Intergenic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
950607503 3:14096023-14096045 CTGAACTCGCGGGAGGTGGCAGG - Intergenic
952492119 3:33882755-33882777 CTCCACAAGCGTGGGGTGGTGGG - Intergenic
955221417 3:57026424-57026446 CTGTGCAAGCGTGGGGTGGGAGG - Intronic
959959271 3:112277994-112278016 CTGAAGCAGCGTGAGCTAGATGG - Intronic
962082393 3:132154210-132154232 ATGAAAAAACGTGAGGGGGAGGG + Intronic
963618362 3:147572469-147572491 CTACACAAGGGTGAGGTGGGAGG - Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
976051793 4:81018597-81018619 CTGAACAAGTATGAAGTGAAAGG + Intergenic
978293445 4:107174445-107174467 CTGGACAAGCTTGATGTAGAAGG - Intronic
980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
995250780 5:109991051-109991073 CTGAACAAAAAAGAGGTGGAGGG + Intergenic
997383474 5:133454376-133454398 CTGGACAAGCTTCAGCTGGAAGG + Intronic
998859089 5:146425466-146425488 CTGAACAAACCTGATGAGGAGGG + Intergenic
1002056712 5:176602083-176602105 CTGAAGCAGCGTGAGGGAGAGGG - Intronic
1002772853 6:304218-304240 CTGGCCAAGGGTGAGGTGGGCGG + Intronic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1008871644 6:56279173-56279195 AAGAACAAGAGTGAGGTGGGAGG - Intronic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1017031042 6:150222358-150222380 GTGTACATGTGTGAGGTGGATGG - Intronic
1020131886 7:5563298-5563320 CTGCCCCAGCCTGAGGTGGAGGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023971476 7:44994400-44994422 CTGAGCCAGACTGAGGTGGAGGG - Intergenic
1031368150 7:120928894-120928916 CAGAACAAGCCTTATGTGGAGGG - Intergenic
1033778963 7:144647148-144647170 CTGATCAAGAGTGGGGTGGCAGG + Intronic
1034437133 7:151068067-151068089 CTGGCCAGGCGGGAGGTGGAGGG - Intronic
1041599166 8:59695214-59695236 CTGAAAATGGGTAAGGTGGAAGG + Intergenic
1042524558 8:69750547-69750569 CTGAACAAGCGTTTTGTGGTTGG - Intronic
1048125807 8:131634766-131634788 CTGAGCAAGAGTGAGATTGAAGG - Intergenic
1048477225 8:134754666-134754688 TTGAAGAAGGGTGAGGTGGGTGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1051145441 9:14022487-14022509 ATGAACATGCATGAGGTGGCTGG - Intergenic
1056262365 9:84861922-84861944 ATGAACAAGCATAGGGTGGATGG - Intronic
1060398972 9:123336644-123336666 CTGAACAAATGTGAGGTGTGGGG + Intergenic
1061012345 9:127963106-127963128 CTGACCAAAGGTGGGGTGGAAGG + Intronic
1190132782 X:47766416-47766438 CTGAACAAGAGAAAGTTGGAGGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1195229922 X:102835997-102836019 CTGAACTAGTGTAAGCTGGAAGG + Intergenic
1198265842 X:135007951-135007973 CTCAACTAGGGTGAGGTGAAAGG + Intergenic