ID: 1096571277

View in Genome Browser
Species Human (GRCh38)
Location 12:52524658-52524680
Sequence TGCTCCCCACAGCCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 553}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096571277_1096571290 30 Left 1096571277 12:52524658-52524680 CCTGCAGGGGGCTGTGGGGAGCA 0: 1
1: 0
2: 6
3: 59
4: 553
Right 1096571290 12:52524711-52524733 CCGATTGGCCCTGGCAGGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1096571277_1096571287 21 Left 1096571277 12:52524658-52524680 CCTGCAGGGGGCTGTGGGGAGCA 0: 1
1: 0
2: 6
3: 59
4: 553
Right 1096571287 12:52524702-52524724 ATTCAGCAGCCGATTGGCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1096571277_1096571288 25 Left 1096571277 12:52524658-52524680 CCTGCAGGGGGCTGTGGGGAGCA 0: 1
1: 0
2: 6
3: 59
4: 553
Right 1096571288 12:52524706-52524728 AGCAGCCGATTGGCCCTGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 127
1096571277_1096571286 15 Left 1096571277 12:52524658-52524680 CCTGCAGGGGGCTGTGGGGAGCA 0: 1
1: 0
2: 6
3: 59
4: 553
Right 1096571286 12:52524696-52524718 CCTTAGATTCAGCAGCCGATTGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096571277 Original CRISPR TGCTCCCCACAGCCCCCTGC AGG (reversed) Intergenic
900422605 1:2562088-2562110 TGCTCCCCACATCCCACAGGGGG - Intronic
900488220 1:2933539-2933561 TGCTCCCCGCAGACCCCTGTAGG + Intergenic
900488230 1:2933570-2933592 TGCTCCCCGCAGACCCCTGCAGG + Intergenic
900548760 1:3243184-3243206 TGTGGCCCACAGCCCGCTGCTGG + Intronic
900665292 1:3811056-3811078 GGCTGCCCACTGCCCTCTGCTGG + Intergenic
900882351 1:5391135-5391157 TGCTCCCCTGAGCCCCGCGCAGG - Intergenic
900899568 1:5507636-5507658 TGCTGCCCACACCCCACTGCAGG + Intergenic
900987672 1:6082658-6082680 TGCTCCCCACAGCACTTGGCCGG - Intronic
901053383 1:6437175-6437197 TGGTACCCACAGCCTCCTGCAGG - Intronic
901528940 1:9841882-9841904 TGACTCCCACAGCCCCCTGGAGG + Intergenic
902256388 1:15191505-15191527 TGGCCCCCAGAGGCCCCTGCTGG + Intronic
902480893 1:16710988-16711010 TGGTACCCACGGCCTCCTGCAGG + Intergenic
902574924 1:17371827-17371849 TCCTCCCAACTGCCCTCTGCAGG + Intergenic
903312645 1:22471894-22471916 TGCTTCCCACAGCCCCTCGCCGG - Intronic
903534862 1:24060234-24060256 GGCGCCCCTCAGCCCCCTGCAGG + Intronic
903778046 1:25805767-25805789 CCCACCCCACAGCCCTCTGCTGG - Intronic
904201570 1:28823048-28823070 TCCACCCCACAGCTCCCAGCCGG - Intronic
904875630 1:33652451-33652473 TTCTCTCCTCAGCTCCCTGCGGG - Exonic
905182265 1:36174840-36174862 TGCCCCCCACTGGCTCCTGCCGG + Intronic
905594196 1:39191819-39191841 AGCTCCTCTCAGCTCCCTGCAGG - Intronic
905872593 1:41413560-41413582 TTAACCCCACAGCCCCCTGGTGG - Intergenic
906703354 1:47876053-47876075 TGCTCCCTCCAGCCCACTGGAGG + Intronic
906801191 1:48738518-48738540 AGTTCCCCACTGCTCCCTGCTGG + Intronic
907276854 1:53321541-53321563 CGCTCCTCACTGCCCCCTGGGGG + Intronic
907329458 1:53661691-53661713 TCCTCCCCACGGCTCCCTGTGGG + Intronic
907704302 1:56819518-56819540 TACTCTCCCCAGTCCCCTGCAGG - Intronic
909608913 1:77532793-77532815 TGCCCCCAACATCACCCTGCTGG - Intronic
909622279 1:77682452-77682474 TGCCCTCCCCATCCCCCTGCGGG - Intronic
910205214 1:84742838-84742860 TGCTCCCCACAGCCACCCTCTGG - Intergenic
910835229 1:91501448-91501470 TTCTCCCTGCAGCCCCCTGCCGG + Intronic
911274154 1:95840549-95840571 TGCTCCCCACAACTGGCTGCAGG + Intergenic
911359785 1:96862507-96862529 TGCTATCAACAGTCCCCTGCAGG + Intergenic
913660269 1:121000904-121000926 TGTGCCCCAAAGCCCACTGCAGG - Intergenic
913714332 1:121519110-121519132 TGCAGCCCTCAGCCCGCTGCTGG - Intergenic
914011635 1:143784061-143784083 TGTGCCCCAAAGCCCACTGCAGG - Intergenic
914166198 1:145177073-145177095 TGTGCCCCAAAGCCCACTGCAGG + Intergenic
914650259 1:149692721-149692743 TGTGCCCCAAAGCCCACTGCAGG - Intergenic
915320336 1:155052664-155052686 TGCTCCTCAGTGCCACCTGCAGG - Exonic
915627208 1:157122217-157122239 TTCTCCCCTCAGCCCACTCCTGG - Exonic
915736156 1:158086745-158086767 TGCTCCCCCCAGCCCACTCACGG - Exonic
916427315 1:164693072-164693094 TGTGCCCCACAGGCCTCTGCAGG + Intronic
917914137 1:179684195-179684217 TGCTCCCCACACCCCACAACAGG + Intronic
918339017 1:183551994-183552016 TGGCCCACACAGTCCCCTGCAGG + Intronic
919738335 1:200967717-200967739 TGTCCCCCACTGCACCCTGCAGG + Intergenic
919939516 1:202276557-202276579 TGCAGCCCCCAGCCCCCAGCAGG - Intronic
920165310 1:204031570-204031592 TCCTAACCACAGGCCCCTGCCGG - Intergenic
920226932 1:204446045-204446067 TGCTCGCCAGCGCCCCCAGCTGG - Exonic
922235294 1:223717991-223718013 TTCTACCCTCAGCCCCATGCTGG + Intronic
922765998 1:228157078-228157100 TCCTCCCTCCAGCCCCCGGCTGG - Intronic
923103840 1:230838936-230838958 TGCTCCCATCAGTCCCATGCTGG + Exonic
923215402 1:231844091-231844113 TGCTCCTCACACACTCCTGCCGG - Intronic
924711202 1:246531329-246531351 AACTCCCCACATCCCCCTACAGG + Intergenic
1062817462 10:511188-511210 TGCTCTCTCCTGCCCCCTGCTGG - Intronic
1063114327 10:3063527-3063549 TGCTGCCCAGAGACCCATGCAGG - Intergenic
1063537611 10:6900587-6900609 TGCTGCACTCAGCCCCTTGCAGG + Intergenic
1067040539 10:42951142-42951164 TTCTCCCCTCAGCCCCTGGCAGG - Intergenic
1067093502 10:43283791-43283813 TGATCCTCACAGCACCCTGTGGG + Intergenic
1067174175 10:43930839-43930861 TCCTCCACACAGCCCCAAGCAGG - Intergenic
1067693676 10:48520386-48520408 TGCTCCCCTTAGGCCCCTCCTGG - Intronic
1070643826 10:78187643-78187665 TGTCCCCCTCAGTCCCCTGCAGG - Intergenic
1071903046 10:90141178-90141200 TGCTCCTCACAGCACCCACCAGG - Intergenic
1072292248 10:93974934-93974956 TGCTCCCCAGAGCCTCCTGAAGG + Intergenic
1072805869 10:98423806-98423828 TTCTGACCACAGCCCCCAGCAGG - Exonic
1074162202 10:110844467-110844489 AGCTCCCCACAGGCCCATGTGGG - Intergenic
1074386508 10:113020681-113020703 TTCTCACCACAGCCCTCTGAAGG + Intronic
1074861259 10:117512156-117512178 CGCCCCCCACACCCCCCGGCTGG + Intergenic
1075225421 10:120624597-120624619 TCCTCCCCACAGCTCTATGCTGG - Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076626658 10:131825018-131825040 AGCTCACCCCATCCCCCTGCGGG - Intergenic
1076745482 10:132510606-132510628 GCCTCCCCACAGGGCCCTGCCGG + Intergenic
1076777607 10:132706743-132706765 TGGCCCCCACAGCTCCCTCCTGG - Intronic
1077062453 11:623871-623893 TGTCCCCCACAGCCCCCCACTGG - Intronic
1077244784 11:1531286-1531308 TACTCCCCACGGAACCCTGCAGG + Intergenic
1077284077 11:1758202-1758224 TGCTCCTAACAGTTCCCTGCTGG - Intronic
1077328751 11:1974805-1974827 GCCTCCCCACAGGCCCCCGCTGG - Intronic
1077384158 11:2261164-2261186 TGCTGCCCACACCGCCATGCAGG - Intergenic
1077541465 11:3148416-3148438 TGCCCCCCACACCTTCCTGCTGG + Intronic
1077998464 11:7474128-7474150 TGCTCCCCTCAGCCACTTTCAGG - Intergenic
1078067713 11:8089209-8089231 TGCTCCCTCCAGCTCCCTACTGG - Intronic
1078088107 11:8246883-8246905 TGGTCACCTCATCCCCCTGCTGG + Intronic
1078464386 11:11539466-11539488 CGCTGCCCACAACCTCCTGCAGG + Intronic
1079078356 11:17397241-17397263 TGCGCTTCACAGCCCCCAGCTGG + Exonic
1079146668 11:17858388-17858410 GACTCCCCCCAGCCCCCTTCCGG + Intronic
1080422834 11:32126898-32126920 GGCTCCCCACACGGCCCTGCTGG + Intergenic
1080658728 11:34278663-34278685 AACTTCCCACAGTCCCCTGCAGG + Intronic
1080775804 11:35385500-35385522 TGCTACCCAGACCCCTCTGCAGG - Intronic
1081658933 11:44876047-44876069 TGGTACCCCCAGCCCCATGCAGG - Intronic
1082800872 11:57414001-57414023 TGCCCCCCATGGCCCCCTGTGGG + Intronic
1083147011 11:60767475-60767497 TGTTCCACACCGCCCCCTGCCGG - Intronic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1083626798 11:64076052-64076074 TCCTTCCCACAGCCTCCTGGTGG + Intronic
1083709007 11:64536097-64536119 TCCTCCCCACCGCCTCCTTCAGG - Intergenic
1083727697 11:64637044-64637066 TGCTTCCCCCAACCCCCTGCTGG - Intronic
1083795445 11:65014186-65014208 TGGTCCCCGGAGCCCCCTCCCGG - Exonic
1083807265 11:65082172-65082194 TTCTCCCCACAGCCCCCAGAGGG + Intronic
1084155537 11:67310804-67310826 TGAGCTCCACAGGCCCCTGCAGG + Intronic
1084965030 11:72739994-72740016 TGCTCCCCACAGTCCCCAAGGGG - Intronic
1084979347 11:72821048-72821070 TGTTCCCCACCCCTCCCTGCTGG - Intronic
1085025379 11:73233409-73233431 GGCATCCAACAGCCCCCTGCAGG - Intronic
1085455005 11:76660672-76660694 TGCCCCTCTCAGCCCCCAGCGGG - Exonic
1086406453 11:86503280-86503302 TGCTGCCCAGATCCTCCTGCAGG + Intronic
1088817043 11:113428499-113428521 TGCCACCCAGATCCCCCTGCAGG - Intronic
1088842771 11:113640569-113640591 TGCTCCACACAGCCCTCTGTGGG - Intergenic
1089660551 11:119982629-119982651 TGCTCAGCACAGCTCCCTGCAGG + Intergenic
1089742920 11:120597316-120597338 TCCTCCCCAGAACCCTCTGCGGG - Intronic
1089772695 11:120815008-120815030 GGCTCCCCCTACCCCCCTGCAGG + Intronic
1091363028 11:134993272-134993294 TGCTCCCCAAAGCCTCCAGAAGG + Intergenic
1202811730 11_KI270721v1_random:29984-30006 GCCTCCCCACAGGCCCCCGCTGG - Intergenic
1091397989 12:165687-165709 TGCTGCTCACAGCCCACTGGGGG + Intronic
1091433060 12:453076-453098 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433081 12:453147-453169 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433103 12:453218-453240 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433125 12:453289-453311 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433147 12:453360-453382 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433169 12:453431-453453 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091433191 12:453502-453524 TGCACCGCAGCGCCCCCTGCGGG - Intergenic
1091718139 12:2794581-2794603 CGCTCCCCACACCCCGCCGCAGG + Intergenic
1092570497 12:9716122-9716144 TGCTCCCCACATCTCCTTTCTGG + Intronic
1094498320 12:31002916-31002938 TCCTCCCCACAGCCCGCAGCTGG - Intergenic
1094627350 12:32136526-32136548 TGTTCCCTGCAGCCCCTTGCTGG - Intronic
1096210767 12:49763805-49763827 TGCTCCCCACTGCCCCAAACAGG - Exonic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096621734 12:52869657-52869679 AGTTCCCCACAGCCCCTTCCAGG + Intergenic
1096750531 12:53756113-53756135 TGCTCTCCACAACCCCCAGCAGG - Intergenic
1097180348 12:57168275-57168297 AGCTGGCCCCAGCCCCCTGCAGG + Intronic
1099892137 12:88602951-88602973 CCCTCCCCCCACCCCCCTGCAGG + Intergenic
1101789225 12:107912499-107912521 TGCTCCACAGCGCCCCCTGCAGG - Intergenic
1102236648 12:111298146-111298168 TGCGCTGCCCAGCCCCCTGCAGG - Intronic
1102599392 12:114017747-114017769 TGTGCCCCACAGCACCCTGCAGG + Intergenic
1103524550 12:121559147-121559169 TGCTCCCCACAGCCCTTCCCTGG - Intronic
1103568940 12:121831258-121831280 CACACCCCACATCCCCCTGCCGG + Exonic
1104070496 12:125340928-125340950 TGCTCCCAACTGGCCCCTGCAGG - Intronic
1104501984 12:129294746-129294768 TGCTCCCATCACCCCCCTGCAGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1107013853 13:35693762-35693784 GTCTCCCCACAGCCTCCTGGGGG + Intergenic
1107768841 13:43767812-43767834 TGCTCCCCTCAGGCTCCTGCCGG - Intronic
1108373224 13:49791906-49791928 TGGTCCCCACCCCCCTCTGCGGG + Intronic
1108815582 13:54286782-54286804 TGTTCCCCACACCACCCAGCTGG - Intergenic
1109760866 13:66827184-66827206 TTCTCCCCATAACCCCCAGCAGG + Intronic
1111531329 13:89541329-89541351 TGGTCCCCACAACCATCTGCTGG - Intergenic
1111949910 13:94702248-94702270 TGATCCCCGCAGCCGCCTGTAGG + Intergenic
1112380287 13:98882519-98882541 TGCTCCCCACAGCCACGTTCTGG + Intronic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1114210170 14:20607269-20607291 TACTCCCCTCAGCCCTCAGCTGG + Intronic
1115687814 14:35814579-35814601 TGCTCCCTGCTGCCCCCTTCTGG + Intergenic
1115852225 14:37597763-37597785 TGCTCCCCGGAGGCGCCTGCGGG - Intronic
1118821114 14:69346884-69346906 TGCTCCTCACCTCCCCCTGCTGG + Intronic
1118896477 14:69949739-69949761 TGCTCCCCCTTGCTCCCTGCTGG - Intronic
1119349227 14:73950374-73950396 AGCTCCCCACAGCGGCCCGCTGG + Exonic
1119382755 14:74239501-74239523 AGCTCCCCCCACCCCCCCGCCGG - Exonic
1119661624 14:76456393-76456415 TCCTCCACACTGCCCCCTGGAGG - Intronic
1120778465 14:88463481-88463503 TTCTCCCTACTGCACCCTGCTGG - Intronic
1121449768 14:93999695-93999717 TTCTCTCCACAGCCACCTACTGG + Intergenic
1121507015 14:94485306-94485328 TGTTCCCTCCAGCCCCCTGTGGG - Intergenic
1122117179 14:99533675-99533697 TGCTCCCACCAGCTCCCTGGGGG - Intronic
1122145733 14:99687945-99687967 GCCTCCCCAGCGCCCCCTGCAGG + Intronic
1122178871 14:99940115-99940137 TGCTCCCCACAGCTCTCGGTGGG - Exonic
1122250837 14:100438570-100438592 AGCTCCCCATAGCCACCTACAGG - Intronic
1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG + Intergenic
1122647059 14:103201878-103201900 CCCTCCCCACAGCCCCCAGGTGG - Intergenic
1122825952 14:104370547-104370569 TGCTCCCTCCAGGCCCCAGCTGG + Intergenic
1122918734 14:104870929-104870951 TGCCCACCGCTGCCCCCTGCCGG + Intronic
1122993930 14:105252455-105252477 TGGTCCCTACAGCAGCCTGCCGG + Intronic
1123026125 14:105425083-105425105 TGCTCCCCCAAGCCGCCTCCCGG - Intronic
1123931217 15:25172563-25172585 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123932902 15:25180425-25180447 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123933325 15:25182313-25182335 TGCTCACCACAGCTCAATGCAGG - Intergenic
1123934473 15:25187464-25187486 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123934899 15:25189339-25189361 TGCTCACCGCAGCTCCGTGCAGG - Intergenic
1123936707 15:25197498-25197520 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123939891 15:25211723-25211745 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123941161 15:25217327-25217349 TGCTCACCACAGCACAGTGCAGG - Intergenic
1123944462 15:25232316-25232338 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123947396 15:25245406-25245428 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123947792 15:25247273-25247295 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123948225 15:25249132-25249154 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123948605 15:25250799-25250821 TGCTCACCACAGCTCAGTGCAGG - Intergenic
1123994687 15:25710274-25710296 TGCTGCCCGGCGCCCCCTGCTGG + Intronic
1124404292 15:29380050-29380072 ACCTCCCCCCAGCCCCTTGCTGG - Intronic
1124626155 15:31308556-31308578 TTCTCCCCACAGCCTGCAGCTGG - Intergenic
1124706622 15:31972024-31972046 AGCTCCCCACCTCCCCCAGCAGG + Intergenic
1125081152 15:35675132-35675154 TGCTTCTCACAGGCCCCTGGAGG + Intergenic
1125300989 15:38252981-38253003 TGCTGCCGCCACCCCCCTGCGGG + Exonic
1126376588 15:48002800-48002822 TGCTCCCTACACCCCCTTTCTGG + Intergenic
1126414883 15:48407109-48407131 TGCTCCCCTGTGCCCCCTGTGGG - Intergenic
1127165691 15:56243549-56243571 GGCGCCCCTCAGCCCCCCGCTGG + Intergenic
1128244800 15:66125882-66125904 TGCCCCCTCCAGCCCTCTGCTGG - Intronic
1128258681 15:66216785-66216807 TGCTGCCCAGAACCCCCTTCAGG + Intronic
1128511342 15:68315791-68315813 CACTCCCCACAGCCCCCTGCTGG + Intronic
1128539566 15:68517184-68517206 TTCTCCTCCCAGCCTCCTGCGGG + Intergenic
1128544058 15:68555570-68555592 TGGTACCCACAGACACCTGCTGG - Intergenic
1128779743 15:70351579-70351601 TCCTCCACTCAGCCCCCTGAAGG + Intergenic
1129332576 15:74835423-74835445 TGCTCCACACTGCCCCCCGATGG + Intergenic
1129946512 15:79543302-79543324 CTCCACCCACAGCCCCCTGCTGG + Intergenic
1130303726 15:82699337-82699359 TTCTCCCCACAGGCCCCCACTGG - Intronic
1130520401 15:84657271-84657293 AGCTCCCCACACCTCCCTGAGGG - Exonic
1130651256 15:85763346-85763368 AGCTCCCCAGAGGCGCCTGCAGG + Intronic
1130653242 15:85774096-85774118 TGCTCCCCACCCCCCGCCGCTGG - Intronic
1130923210 15:88366210-88366232 TTCTCCCCACAGCCCCGTGAGGG + Intergenic
1131347403 15:91663235-91663257 TGATGCCCCCGGCCCCCTGCCGG - Intergenic
1132146821 15:99434024-99434046 TCCTCCCCACAGCGTTCTGCGGG - Intergenic
1132365668 15:101254539-101254561 CCTTCCCCACAGCCCCCTGGAGG + Intergenic
1132499638 16:279808-279830 TGCTCACCCCTGTCCCCTGCCGG + Intronic
1132656494 16:1043826-1043848 AGCTGCCCAGAGCTCCCTGCCGG - Intergenic
1132998788 16:2838802-2838824 TGCTCCTGACAGCCACCTCCAGG + Intronic
1133585421 16:7189735-7189757 TGGTTCCCACAGACACCTGCAGG + Intronic
1134502070 16:14777007-14777029 GGTTCCCCAAAGCCCTCTGCAGG - Intronic
1134537079 16:15034718-15034740 TCCTCCCCACCGCACCCTGGCGG + Intronic
1134578491 16:15351886-15351908 GGTTCCCCAAAGCCCTCTGCAGG + Intergenic
1134724097 16:16405658-16405680 GGTTCCCCAAAGCCCTCTGCAGG - Intergenic
1134943332 16:18306211-18306233 GGTTCCCCAAAGCCCTCTGCAGG + Intergenic
1135381986 16:22003255-22003277 TGCTGCCCAGATCCCCCTTCAGG + Intergenic
1135764877 16:25168945-25168967 TGCTCCCGCCAGCACCGTGCTGG + Intronic
1135816176 16:25636029-25636051 TGCTCCCCAGAGTCACCTGGTGG - Intergenic
1136073590 16:27803405-27803427 TGGTGCCCCCAGCCCCCAGCAGG + Intronic
1136298374 16:29316756-29316778 AGCCCCTCACAGCCACCTGCAGG - Intergenic
1136455211 16:30376401-30376423 TGCTTCCCCCAACCCCCTCCAGG + Exonic
1136750610 16:32632468-32632490 TGCTAGCCACCGCACCCTGCCGG - Intergenic
1136776273 16:32873496-32873518 TGCTCCACCCACCCTCCTGCGGG - Intergenic
1136894342 16:33988016-33988038 TGCTCCACCCACCCTCCTGCGGG + Intergenic
1137044162 16:35640962-35640984 TGCACCCAAGAGCTCCCTGCAGG - Intergenic
1137617384 16:49855899-49855921 CGCTCCCCACAGCCGCCAACCGG - Intronic
1137617746 16:49857140-49857162 CGCTCCTCACATCCTCCTGCTGG - Intronic
1137686492 16:50390457-50390479 TGCTTCTCACAGCCCCCAGCTGG - Intergenic
1137773838 16:51039830-51039852 GGCTCCTCACTGCCCCCAGCAGG - Intergenic
1138185133 16:54971068-54971090 TGCTCCCCACACCCCCTGGTTGG + Intergenic
1138316224 16:56072587-56072609 GGCTCCCCACAGCACTTTGCAGG + Intergenic
1139256587 16:65548632-65548654 TGGTATCCCCAGCCCCCTGCAGG - Intergenic
1139278268 16:65748221-65748243 TACTCCTCACAGACACCTGCAGG - Intergenic
1139390807 16:66605377-66605399 CGCTCCGCACGGCCCCCCGCCGG - Intronic
1139472680 16:67186705-67186727 TCCTCCCCACTGCCCCATGGAGG + Intronic
1139530339 16:67539525-67539547 TGGTCCCTTCAGCCCCCTCCAGG - Intronic
1139914732 16:70421039-70421061 TGCTTCCCAAAGCCACCTGCAGG - Intronic
1140698447 16:77558805-77558827 TGATCTCCACAGCCCCTTCCAGG - Intergenic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1142060034 16:88023261-88023283 AGCCCCTCACAGCCACCTGCAGG - Intronic
1142286378 16:89173176-89173198 TCCACCCCTCAGCCCTCTGCCGG + Intronic
1142402836 16:89869960-89869982 TGCATGCCACAGCCCCCTCCTGG - Intronic
1203052740 16_KI270728v1_random:891674-891696 TGCTAGCCACCGCACCCTGCCGG - Intergenic
1203078688 16_KI270728v1_random:1135605-1135627 TGCTCCACCCACCCTCCTGCGGG - Intergenic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142759336 17:2034200-2034222 TGCCCCCCACCGCCCCCGACCGG - Intronic
1143001483 17:3797937-3797959 GGCTCCCCACTGCCCTCAGCAGG + Intronic
1143248554 17:5505315-5505337 TGCTCCACTCAATCCCCTGCTGG + Intronic
1143283049 17:5769097-5769119 TGCTCCCCACCACCCCCGACAGG - Intergenic
1143363196 17:6387984-6388006 TGCTCTCCACTCCTCCCTGCAGG - Intergenic
1143503666 17:7352478-7352500 TGCTCGCCACCGTCACCTGCTGG + Exonic
1143645745 17:8228882-8228904 TGCTCCCCATAGGCTCCTGGTGG - Exonic
1143870777 17:9956128-9956150 TGTTCCCCACAGGCTCCTGCTGG - Intronic
1144613992 17:16751837-16751859 TGCTCCCCACAGCCATCTGCTGG - Intronic
1144631403 17:16874294-16874316 AGCCGCCCACAGCGCCCTGCTGG - Intergenic
1144649199 17:16996980-16997002 AGCCGCCCACAGCGCCCTGCTGG + Intergenic
1144734956 17:17550158-17550180 TGCTCCCCACCACCCCCCTCTGG + Intronic
1145133654 17:20381889-20381911 TGCTCCCCACAGCCATCTGCTGG - Intergenic
1145268686 17:21392798-21392820 TGCTGCCCACACCCACCTTCAGG - Intronic
1146009262 17:29180459-29180481 TTATCCCCACAGCCGCCAGCAGG - Intergenic
1146517345 17:33499524-33499546 TGTTCCTCACAGCCCTCTGAAGG + Intronic
1146544308 17:33725145-33725167 TGCTCCCCACAGCCTCTCACTGG + Intronic
1146937965 17:36824273-36824295 TGCTCCCCACAGCCTCCTCCAGG + Intergenic
1147141185 17:38461426-38461448 TGCTCCCCAGAGGCCCCTGGTGG + Intronic
1147168822 17:38606502-38606524 GGCTCCCCGGCGCCCCCTGCTGG + Intergenic
1147211442 17:38874686-38874708 TTCTGCTCAGAGCCCCCTGCAGG + Intronic
1147914207 17:43877060-43877082 TGCTCCCCACAGGGCCAGGCTGG - Intronic
1148075282 17:44932177-44932199 TGCACCCCAGAGCTCCCTGCAGG - Exonic
1148587050 17:48788427-48788449 TCTTCCTCACAGCCCCCTGGGGG + Intronic
1150225912 17:63524317-63524339 TGCACTCCTCAGCCCCCAGCAGG - Exonic
1150660089 17:67067703-67067725 TGGTCCCCAAACCCACCTGCTGG - Intergenic
1151453390 17:74212687-74212709 TTTTCCCCAGAGCCCCCTCCTGG + Intergenic
1151490063 17:74427554-74427576 TGCAACCCACAGCCGGCTGCTGG - Intronic
1151547988 17:74805193-74805215 TGCTTCCCACAGCACCATGGTGG + Intronic
1152044832 17:77929061-77929083 TGGGCCCCACAGCCACCTGCTGG - Intergenic
1152395884 17:80032956-80032978 TGCTCCCCATAGCATCCTGCAGG + Intronic
1152687186 17:81700496-81700518 TGCGCCCCAGTGGCCCCTGCTGG - Exonic
1153396800 18:4631423-4631445 AGCACCCCACAGCCTCCTGGTGG + Intergenic
1154131680 18:11742408-11742430 TCCTCACCACAGCCCCATGAGGG + Intronic
1155007379 18:21741162-21741184 TGCTCCCCGCCGCCCCCCTCGGG + Intronic
1155157959 18:23173279-23173301 TGCTGCGCACAGACACCTGCGGG + Intronic
1155267941 18:24112090-24112112 TTCTCCCCACAGCCTCCAGAGGG - Intronic
1156918697 18:42492210-42492232 TGCTCCACACAGTCCCATGCAGG + Intergenic
1157682284 18:49616453-49616475 TGCTCCCCACAGTCTCGTGGGGG - Intergenic
1158326569 18:56319661-56319683 CTCTGCCCACAGCACCCTGCTGG - Intergenic
1158695216 18:59697431-59697453 TGCTCTCCGGCGCCCCCTGCCGG - Intergenic
1160245628 18:77156564-77156586 TGCACGCCTCAGCCCCCAGCCGG - Intergenic
1160256472 18:77251711-77251733 GGGTCCCCACAGCTCCCTCCCGG + Intronic
1160273242 18:77407315-77407337 TCCTCCCCACAACACCCTCCTGG - Intergenic
1160704692 19:524478-524500 TCCTCCCAACAGTCCTCTGCTGG + Intergenic
1160809689 19:1008016-1008038 GGCTCCCCACTGCCCCCAGGAGG - Intronic
1160890132 19:1373366-1373388 TGCTGCCCACAGCGACCAGCTGG - Intronic
1160904302 19:1445326-1445348 TTCTCCCCGCAGCCGCCAGCGGG + Intergenic
1161360907 19:3849169-3849191 TTGCCCCCACAGCCCTCTGCTGG - Intronic
1161512037 19:4677309-4677331 AGCTCCCCACTGCCCCCTAGGGG + Intronic
1162155809 19:8677400-8677422 TGGTGACCACAGCCCCCAGCAGG - Intergenic
1163033058 19:14556822-14556844 CGCTCCCCACTGCCCCCTTGTGG - Intronic
1163266245 19:16224250-16224272 TGCACCCCACAGCACCCAGATGG - Intronic
1163405760 19:17121296-17121318 TCCTCACCACAGCCCACTGAAGG + Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1163785145 19:19271115-19271137 CCCTCTCCACAGCCCCCTGTGGG - Exonic
1163851795 19:19668621-19668643 TGCTACCCACAGCCCCTCGCTGG - Intergenic
1164156972 19:22602915-22602937 CCCTCCCCGCAGCCCCCCGCCGG - Intergenic
1164393878 19:27847285-27847307 TGCCCGCCACTGCCCCCAGCTGG + Intergenic
1164585811 19:29475140-29475162 TACACCCCTCACCCCCCTGCAGG - Intergenic
1164669632 19:30065068-30065090 AGCTGCCCACGGCCCCCTGGAGG - Intergenic
1164880226 19:31726681-31726703 ACCTCCCCACACCTCCCTGCTGG + Intergenic
1164952177 19:32345843-32345865 TCCTCCCCTCAGGCCTCTGCCGG + Intronic
1166502919 19:43354371-43354393 TGGGCCCCACAGCCCCCAGCAGG + Exonic
1166523109 19:43494701-43494723 TTCTGTCCACAGCTCCCTGCAGG - Exonic
1166979430 19:46623979-46624001 TGCGCGCAACAGCTCCCTGCTGG - Exonic
1167075708 19:47247559-47247581 TGCGCCGCACCGCCCCCTGGTGG + Intergenic
1168237895 19:55075154-55075176 TTCTCCCCAGAGCCCCGTGAGGG - Intronic
1202714930 1_KI270714v1_random:36893-36915 TGGTACCCACGGCCTCCTGCAGG + Intergenic
925283190 2:2699129-2699151 TCCTCACCACTGGCCCCTGCAGG - Intergenic
925763604 2:7209963-7209985 GGCTCCCCACCGCCCTCAGCAGG - Intergenic
926053800 2:9761913-9761935 TGCTCCCCAAAACCCCCAGCTGG + Intergenic
926434472 2:12824257-12824279 TCCTCTCCACAGCCCCCAGAAGG - Intergenic
927094094 2:19734696-19734718 TGAACCTCACAGCCTCCTGCTGG + Intergenic
927204034 2:20595751-20595773 TTGTCTCCACAGTCCCCTGCTGG + Intronic
927676758 2:25111858-25111880 TGCTCCCCAGAACCCCCAGAAGG + Intronic
927853361 2:26513496-26513518 ACCTCCCCGCAGCCCCCAGCAGG + Intronic
927887103 2:26725306-26725328 TGCCCGCCAGAGCCCTCTGCAGG - Intronic
928166430 2:28975908-28975930 AGCTCCCCACTGGGCCCTGCTGG + Intronic
928269602 2:29844321-29844343 TGCTCCCCACTGGCCCCGGGGGG - Intronic
929079248 2:38106151-38106173 AGCTCCTCACAGCCGCCTGCGGG - Intronic
930254005 2:49068166-49068188 TGCTCCCTATAGCCCCCTTGAGG + Intronic
931752908 2:65346684-65346706 ATCTCCCCACTGCACCCTGCTGG + Intronic
932320284 2:70817231-70817253 TGCTCCCCCAAGCACCCTCCTGG + Intronic
932777934 2:74539640-74539662 TGCTCCCTTCACCTCCCTGCAGG + Intronic
933278055 2:80303706-80303728 TGCTGCCCGCCGCCCCCAGCGGG - Exonic
933702646 2:85266649-85266671 AGCTCCACACTGCCCCCTGGTGG - Intronic
934770857 2:96906966-96906988 TGCTCCCCTCACCCCCGGGCCGG - Intronic
935208586 2:100919485-100919507 TGCTCCCTACCGCCCCCAGCGGG - Intronic
935292563 2:101622528-101622550 TGCCACCCACCGCCCCCCGCCGG + Intergenic
936246881 2:110836193-110836215 TACCCCCAACAGCCCCCTCCAGG - Intronic
936569399 2:113602142-113602164 TGGTCGCCAGCGCCCCCTGCTGG - Intergenic
936569932 2:113604188-113604210 TGCTGTCCAGCGCCCCCTGCTGG + Intergenic
937250648 2:120521717-120521739 TGCTGCCCCCAGCACACTGCTGG + Intergenic
937257833 2:120567342-120567364 TCCTCCCCACAGCCTCCTCCAGG + Intergenic
937275746 2:120682890-120682912 TGCTCCCCAGGCCCCCCTGAGGG + Intergenic
937298411 2:120823686-120823708 TCCTCTCCACAGCCCACAGCCGG - Intronic
937976278 2:127583833-127583855 AGCTTCTCACAGCCCCCTGCCGG - Intronic
938114724 2:128595328-128595350 TGCTCAGCAGAGCTCCCTGCTGG - Intergenic
938131104 2:128716199-128716221 TGCTACACACAGCCCACTGTAGG - Intergenic
938558525 2:132448980-132449002 AGCTCTCCGCAACCCCCTGCAGG + Intronic
939738315 2:145877300-145877322 TCCATTCCACAGCCCCCTGCAGG - Intergenic
940986340 2:160055901-160055923 TTCTCCCCACTGCCGCCTCCAGG + Intronic
941160752 2:162031609-162031631 TCCTCCTCACTGCACCCTGCTGG + Intronic
941831595 2:169967229-169967251 TGCCCCCCCCACCCCCCTACAGG + Intronic
943079768 2:183244661-183244683 TGCTCCACTGAGCCTCCTGCTGG - Intergenic
946757992 2:222965741-222965763 TCCCTTCCACAGCCCCCTGCAGG - Intergenic
948394190 2:237632428-237632450 TGCCCCCCTCATGCCCCTGCTGG + Intronic
948631455 2:239305454-239305476 TGAGCCCAACAGCGCCCTGCAGG + Intronic
948653083 2:239461213-239461235 GCCTTCCCACAGGCCCCTGCTGG + Intergenic
948733467 2:239982183-239982205 TACTCTGCACAGCCCGCTGCGGG + Intronic
948737858 2:240021460-240021482 TAGTCCCCACTGCTCCCTGCGGG - Intronic
948784582 2:240345713-240345735 TCTTCCCCACAGCCCCCAGGAGG - Intergenic
948908137 2:240989535-240989557 TGGGCCCCACTGCCCTCTGCCGG - Intronic
949088831 2:242182153-242182175 TGCTGTCCAGCGCCCCCTGCTGG - Intergenic
1168815914 20:736941-736963 TGGTCCCCACAGCCTCCTCCTGG - Intergenic
1171147235 20:22795542-22795564 TCCTCCTCACAGTCCCCTTCTGG - Intergenic
1172428429 20:34871949-34871971 TGTTCCCCTCAGCCCTCTGCTGG - Intronic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172969138 20:38860908-38860930 TGCTCCCAGGGGCCCCCTGCAGG + Intronic
1173192223 20:40885486-40885508 TGCTCCCCCGACCCCCCAGCAGG + Intergenic
1173407335 20:42778062-42778084 TGCCACCCACACCCCTCTGCAGG + Intronic
1173865916 20:46312646-46312668 TGCTCCCTACGCCCCCCGGCGGG - Intergenic
1174140003 20:48406064-48406086 TGCTCCCCAACTCCTCCTGCTGG - Intergenic
1174178544 20:48659868-48659890 TCCTTGCCAGAGCCCCCTGCAGG - Intronic
1174565975 20:51464692-51464714 AGGTGCCCACAGCCCCCTGGAGG + Intronic
1175004352 20:55666405-55666427 TTCTCCCCACAGTCCCCAGCAGG - Intergenic
1175182636 20:57159425-57159447 TGCTCCCATCAGCCCGCTGAGGG + Intergenic
1175238124 20:57526715-57526737 GGTTCCCCAGCGCCCCCTGCAGG - Intergenic
1176081890 20:63277679-63277701 TGCGTCCCACATCCCACTGCAGG + Intronic
1176093541 20:63329399-63329421 TGCTCCACACAGGCGCCTCCTGG - Intronic
1176108138 20:63399129-63399151 TGGACCCCACGGCCCCCTCCAGG - Intergenic
1176108170 20:63399202-63399224 CGGACCCCACAGCCCCCTCCAGG - Intergenic
1176115170 20:63429059-63429081 TGCCGCCCACAGCCACCAGCAGG + Intronic
1176131823 20:63499480-63499502 TGCTCCCCTCCCCCGCCTGCCGG - Intergenic
1177302109 21:19261186-19261208 TGCTCCCCAATGCCACCTACAGG + Intergenic
1178736978 21:35161349-35161371 TGCTCCCCACAGTCTCCATCTGG + Intronic
1178893879 21:36543010-36543032 TGCTCCCCCCTGCCCCCGCCAGG - Intronic
1179347056 21:40568451-40568473 TCCTTCCCACAGACCACTGCAGG + Intronic
1179504801 21:41833318-41833340 TGCCCCCCACACCCCTCTCCAGG + Intronic
1179910451 21:44444627-44444649 TGCTCCACACTGCCCCCAGCGGG - Intergenic
1180067006 21:45417604-45417626 TGCTCCCTCCAGCTCCCTGATGG + Intronic
1180613010 22:17109617-17109639 AGCTCCCCGCAGCCCCCCGAGGG + Exonic
1180987891 22:19916188-19916210 TGGGCACCACAGCTCCCTGCTGG - Intronic
1181014517 22:20061518-20061540 TGCTCCTCACAGGCACCTACGGG + Exonic
1181037151 22:20175213-20175235 AGCTGCCCACACCGCCCTGCTGG + Intergenic
1181181898 22:21074275-21074297 AGCTCCCCACAGCACACGGCAGG + Intergenic
1181604334 22:23971203-23971225 TGCTCTCCACACCCATCTGCAGG - Intronic
1181645812 22:24231422-24231444 TACTCACCACCGCCGCCTGCAGG - Exonic
1182516841 22:30863837-30863859 TGCTCCCCACTCCCCACAGCAGG - Intronic
1184595130 22:45509292-45509314 TTCTCCCCACAGTTCCCTCCAGG - Intronic
1184675448 22:46039747-46039769 TGTTCCCTAGAGCCCCTTGCAGG - Intergenic
1184759663 22:46537311-46537333 TGGTCCCCACAGTCCCCGCCAGG - Intergenic
1185132419 22:49046714-49046736 GGCTCCCCACCGCCCTCTGGAGG - Intergenic
1185423103 22:50746153-50746175 TGCCCCACACTGCCCCATGCTGG + Intergenic
949185447 3:1186669-1186691 TCCTCCCCACAGCCACTTTCAGG - Intronic
950124802 3:10504707-10504729 GGCTCCTCCCTGCCCCCTGCAGG - Intronic
950452505 3:13073199-13073221 GGCCCTCCACAGCCCGCTGCTGG - Intergenic
951182239 3:19672062-19672084 AGCTACCCACTGCCCACTGCTGG - Intergenic
953538838 3:43796526-43796548 TCCTCCCCACTGCTCCCTGCCGG + Intergenic
953907505 3:46875739-46875761 TGCTGCCCACAGCTCCCAGCAGG + Intronic
954108652 3:48422387-48422409 TGCTCACTGCAGACCCCTGCTGG + Exonic
954183184 3:48897795-48897817 TGCTCCCCACAGGCCCACCCTGG + Intronic
954683158 3:52356691-52356713 TGCTCTCCACAGGCAGCTGCTGG - Exonic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
960157198 3:114308015-114308037 TGCTCTCCACAGAGCCCAGCAGG - Exonic
961394411 3:126577278-126577300 TGCTCACCACACACCACTGCAGG + Intronic
961566895 3:127770455-127770477 CCCTCCCCACAGCCCCTTGGAGG + Intronic
962350101 3:134650433-134650455 TCCCCCCCACAGCACACTGCAGG - Intronic
963851016 3:150210653-150210675 TGCTTCCTACAGGCCCCTGCAGG - Intergenic
964087403 3:152834980-152835002 TGCTTCCCACTGCGCCCTGGAGG + Exonic
966080004 3:175989281-175989303 TGTTCCTCACAGCCATCTGCTGG - Intergenic
966949502 3:184803464-184803486 TGCTCCCCACTGCCACTTGGTGG + Intergenic
966975800 3:185082290-185082312 GTGTCCCCACAGCCCCCTGCAGG + Exonic
967147022 3:186615036-186615058 TGCTCTCTACTTCCCCCTGCTGG - Intronic
967171151 3:186824702-186824724 TGCTCTCCCCAGGGCCCTGCAGG - Intergenic
968443076 4:634266-634288 TCCTGCCTTCAGCCCCCTGCAGG - Intronic
968605574 4:1533577-1533599 CTGTCCCCACAGCCCCCTGCCGG - Intergenic
968620477 4:1601517-1601539 TGCGCCCCCCAGCCCCCACCTGG + Intergenic
968620829 4:1602812-1602834 TGCTGCCCTCAGACCCCTCCTGG - Intergenic
969158833 4:5237312-5237334 TGCACCCAACAGTCCCCTGCAGG - Intronic
969309570 4:6345653-6345675 TGCTCCCCAGAGCCTCCCGAAGG + Intronic
971330468 4:25677316-25677338 TGCTCCCCACATTCCCCATCAGG + Exonic
971734124 4:30424247-30424269 TTTGCCCCACAGCCCCCAGCAGG + Intergenic
974137509 4:57836840-57836862 TCCTCCTCACAGCCCTCTGAAGG - Intergenic
975870755 4:78776319-78776341 CCCTCCCCACCGCCCTCTGCGGG + Intergenic
976750853 4:88450238-88450260 TGCTCCCCACATCCCTCTTAAGG + Intergenic
977310769 4:95384482-95384504 TGCTCTGCTCAGCCCCCTCCTGG - Intronic
978761634 4:112359652-112359674 TCCTCCCCCAAGGCCCCTGCTGG - Intronic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
979674668 4:123398319-123398341 CGCTCCCCGCGGCCCCCTTCCGG - Intronic
982095354 4:151917242-151917264 TGCTGGCCGCAACCCCCTGCTGG - Intergenic
982157270 4:152535387-152535409 CCCTCCCCTCAGCCCCCTCCGGG - Exonic
983781423 4:171674663-171674685 TGCCCACCCCAGCCCCCTTCCGG + Intergenic
984734851 4:183099367-183099389 TGCGCCCCTCAGCCCCTCGCCGG + Exonic
985466660 4:190203360-190203382 TGCTGTCCAGCGCCCCCTGCTGG - Intergenic
985573696 5:664007-664029 GGCTCTGCTCAGCCCCCTGCTGG + Exonic
985763744 5:1765509-1765531 TGTTCAGCACAGCCCGCTGCTGG + Intergenic
986150893 5:5129675-5129697 TGCTGCCCACAGCACCATGGTGG + Intergenic
986290065 5:6392711-6392733 TTCTCCCCGCAGCCCCCAGAAGG - Intergenic
989268285 5:39502882-39502904 TGCTTCCCTCAGCCCCCTTTGGG + Intergenic
989671981 5:43928711-43928733 TGCTCCCCACAACCCCCAACAGG - Intergenic
994023060 5:95050432-95050454 TCATCCCCACAGCCCCATCCAGG - Intronic
995805867 5:116051709-116051731 TCCTCCCCACTGCTCACTGCGGG + Intronic
995960092 5:117829407-117829429 TGTTCCCCACACCACCCAGCTGG - Intergenic
997367862 5:133337161-133337183 TGCCCACCACAGCCCCATGCTGG - Intronic
997406641 5:133654288-133654310 TCCTCCCCACAGTCCTCTGAAGG + Intergenic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
998559175 5:143155183-143155205 TGCTCCCCACAGTGCCCTTGGGG + Intronic
999125355 5:149242175-149242197 TGCTCAGCAGAGCCCCATGCAGG - Intronic
999255757 5:150209277-150209299 TCCTGGCCACAGCCCCCTGGCGG - Intronic
999291618 5:150429632-150429654 TGACCTCCACAGCCCCCAGCAGG - Intergenic
999390722 5:151187496-151187518 TTCTCCCCAAAGCCTTCTGCAGG + Intronic
999625484 5:153516407-153516429 TGATCCCCACAGCACCCTTTGGG + Intronic
999802359 5:155049875-155049897 AACTCCCCACAGCCCCATCCAGG + Intergenic
1000795159 5:165656012-165656034 TCCTCCCCACACACCCTTGCTGG + Intergenic
1001116272 5:168942923-168942945 TCCTCCCCCTAGCCCACTGCAGG - Intronic
1002569422 5:180131572-180131594 AGCTCCACACAGCCAACTGCGGG + Intronic
1002597576 5:180334336-180334358 TTCTCCCCAGAGCACTCTGCAGG - Intronic
1002888233 6:1313636-1313658 TCCTCCCCGCGGCGCCCTGCAGG + Exonic
1003071338 6:2947780-2947802 TGCTCCCCCCACCTCCATGCAGG + Intergenic
1003120472 6:3315261-3315283 TGCTCCCCCGACCTCCCTGCAGG - Intronic
1003429337 6:6024687-6024709 TGCTCCTCACAGCCCTCAGAAGG - Intergenic
1003502544 6:6714255-6714277 TGCTCACCACCTCCCCTTGCAGG - Intergenic
1003935144 6:10968448-10968470 TGCTCCCCACTGCCACATGCAGG - Intronic
1005865956 6:29936666-29936688 TGCTCCCAACAGTCTCCTTCTGG + Intergenic
1006020169 6:31112998-31113020 TGCACCCCAGAACCTCCTGCAGG - Intergenic
1006020293 6:31113915-31113937 TCCTCCCCACCTGCCCCTGCTGG + Intergenic
1006102118 6:31691908-31691930 TGTTCCCCACAGCTACCTGGTGG - Exonic
1006334790 6:33414917-33414939 TTATCCCCCCAGCCCCCTCCCGG - Intronic
1006836447 6:37001845-37001867 TGCTCCCCCTACCTCCCTGCCGG - Intergenic
1006869742 6:37240596-37240618 CTCTCCCCATAGTCCCCTGCAGG - Intronic
1007095164 6:39208434-39208456 TTCTTCTCAAAGCCCCCTGCAGG + Intronic
1007203493 6:40130815-40130837 TGCAGCCCACAGCCACCTGTTGG - Intergenic
1008584159 6:52933874-52933896 TCCTCCCCACAGCCCCTGGTGGG - Intergenic
1008720503 6:54344364-54344386 TGCTCCCCACACCCCCTCTCTGG + Intronic
1009625718 6:66137237-66137259 TGGTCCCCACAGCTGCCTGCTGG + Intergenic
1011797927 6:90978032-90978054 TCCTCCCCACAGCCTCCAGAAGG + Intergenic
1015376138 6:132512808-132512830 GGCTCCCCACGCCCCCCGGCCGG - Intronic
1015965387 6:138692398-138692420 TGCTCCCGCCCGCCCCCTGGCGG - Intronic
1016356790 6:143227310-143227332 TACTCCACACAGGACCCTGCTGG - Intronic
1016465648 6:144322453-144322475 TGCTCCACAAAGTCCCCTGCAGG - Intronic
1016488215 6:144566758-144566780 TGCTCCCCACTGCTACCTCCAGG - Intronic
1016876617 6:148871640-148871662 AACTCCCCACAGCCACATGCAGG + Intronic
1017716802 6:157218653-157218675 GGCTCCCCAAGGCCCCCGGCTGG + Intergenic
1018758137 6:166867153-166867175 TGCTCACCTCATCCCCCAGCTGG - Intronic
1019108399 6:169689726-169689748 TGTACCCCACACCCCACTGCAGG + Intronic
1019161018 6:170066855-170066877 TTCTCCTCACAGCTCCCTCCCGG + Intergenic
1019298334 7:290570-290592 TGCGCCCCACGGCGTCCTGCGGG + Intergenic
1019459982 7:1152752-1152774 TGCTCCCCGCAGCCCTCAGAAGG + Intronic
1019509621 7:1411251-1411273 CCCTCCCCACAGCCCCCTGGGGG + Intergenic
1019715703 7:2538323-2538345 TGCTTCCTACAGCAGCCTGCGGG - Exonic
1019815944 7:3200684-3200706 AGCTCTCCACTGGCCCCTGCTGG + Intergenic
1021959582 7:25858611-25858633 CTCTCCCCGCAGCCCGCTGCAGG + Intergenic
1022977981 7:35575912-35575934 TGCTCCCCACAACCCACGGAGGG - Intergenic
1023180502 7:37477603-37477625 AGCTCCCCACAGGAGCCTGCAGG + Intergenic
1023291779 7:38675741-38675763 TTCTCCCCACGGCCGCCTGAAGG + Intergenic
1023925529 7:44666714-44666736 TCCTGCCCACATCGCCCTGCAGG + Exonic
1023970232 7:44985576-44985598 CTCTTCCCACAGCCCCCAGCAGG - Intergenic
1024250976 7:47505476-47505498 CGCTCCACACAGCCCCCAGGAGG + Intronic
1024814595 7:53254195-53254217 GGCTCCCCACAGTGCCCTTCAGG + Intergenic
1025757272 7:64357033-64357055 TGGTGCCCACAGCCCCTTCCTGG - Intergenic
1026876227 7:73880534-73880556 TCCCCTCCACAGCCCGCTGCTGG + Intergenic
1027129324 7:75579965-75579987 TCCTCCCCACATCTCCCAGCAGG - Intronic
1028256922 7:88610550-88610572 TGCTCCCCACAGTGTACTGCAGG + Intergenic
1029513643 7:101012605-101012627 TGCTCCCAACAGCCCCCTCTCGG + Intronic
1029617663 7:101669512-101669534 TGCTCCACACTGCCTCCTGCTGG - Intergenic
1029656214 7:101926465-101926487 TCTTCCCTACAGGCCCCTGCTGG - Intronic
1029942442 7:104494852-104494874 TGCTTCACACAACCCCCAGCTGG + Intronic
1031980698 7:128122502-128122524 TGCCCCCCCCACCCCCCGGCCGG + Intergenic
1032458613 7:132092927-132092949 TTCTCCCCACTGTCCCCTCCTGG - Intergenic
1033552264 7:142458231-142458253 AGCTCCCCACAGGCTCCAGCAGG + Intergenic
1033554528 7:142477180-142477202 AGCTCCCCACAGGCTCCAGCAGG + Intergenic
1033559153 7:142514724-142514746 AGCTCCCCACAGGCTCCAGCAGG + Intergenic
1033899409 7:146116725-146116747 TTCTCCCCTCACCCCCCTCCAGG - Exonic
1034339640 7:150343574-150343596 TGGCCCCCACAGACCCATGCTGG + Intergenic
1034792859 7:153987690-153987712 AGCACCCCACAGCTCTCTGCTGG - Intronic
1035796356 8:2360864-2360886 TCCTCCCCACATCCTCATGCGGG - Intergenic
1038544549 8:28415110-28415132 TGCTTCCCACGGTCCACTGCAGG + Intronic
1038661917 8:29504925-29504947 TGCTTCCCCCAGCTCCTTGCAGG + Intergenic
1040979327 8:53229536-53229558 TGCTCCCCAGAGCCTCCACCAGG + Exonic
1041117152 8:54550936-54550958 CCCTCCCCACAGCACACTGCTGG + Intergenic
1041259331 8:56006578-56006600 TGCTCCCCACCACCTCCTTCTGG + Intronic
1043134150 8:76500394-76500416 AGCTCCCCACAGCCCAGGGCAGG + Intergenic
1043890081 8:85644444-85644466 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043891622 8:85656358-85656380 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043891656 8:85656496-85656518 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043891692 8:85656634-85656656 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043892694 8:85663195-85663217 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043892728 8:85663333-85663355 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043892764 8:85663471-85663493 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043895480 8:85735318-85735340 TGCGAGCCACAGCTCCCTGCTGG + Intergenic
1043895516 8:85735456-85735478 TGCGAGCCACAGCTCCCTGCTGG + Intergenic
1043895550 8:85735594-85735616 TGCGAGCCACAGCTCCCTGCTGG + Intergenic
1043897129 8:85746214-85746236 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043897163 8:85746352-85746374 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043897199 8:85746490-85746512 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043899455 8:85764582-85764604 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043899489 8:85764720-85764742 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043899525 8:85764858-85764880 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043901063 8:85776775-85776797 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043901097 8:85776913-85776935 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043901133 8:85777051-85777073 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043903027 8:85792050-85792072 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043903061 8:85792188-85792210 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043903097 8:85792326-85792348 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043904637 8:85804243-85804265 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043904670 8:85804381-85804403 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043904706 8:85804519-85804541 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043906249 8:85816434-85816456 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043906283 8:85816572-85816594 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043906319 8:85816710-85816732 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1043907857 8:85828624-85828646 TGCGAGCCACAGCTCCCTGCTGG - Intergenic
1045033910 8:98162719-98162741 TGCTCCCCACACCCTGCTTCAGG - Intergenic
1045336036 8:101205350-101205372 CGGTCCCCACCGCCCCCCGCTGG + Intronic
1045815171 8:106270335-106270357 CGCTCACCGCAGCCCCCTCCTGG + Intronic
1047486360 8:125334556-125334578 TCCTTCCCACCTCCCCCTGCTGG + Intronic
1047533793 8:125700828-125700850 TGCCCTCCACTGCCCCCAGCAGG + Intergenic
1047955779 8:129974133-129974155 TCCTCCCCACAGCACTCTGTAGG + Intronic
1048901002 8:139037851-139037873 TGCTCTCTGCTGCCCCCTGCGGG - Intergenic
1049228034 8:141467010-141467032 TGCACCCCTCACCTCCCTGCAGG + Intergenic
1049383933 8:142331457-142331479 TGCTGCCCCCTGCCCGCTGCTGG - Intronic
1049556454 8:143284802-143284824 TGCTCCACAATGCCCCCTGCTGG + Intergenic
1049644851 8:143731651-143731673 TGGTGCCCACAGGGCCCTGCAGG + Intronic
1049883133 9:11387-11409 TGGTGGCCACCGCCCCCTGCTGG + Intergenic
1050243175 9:3659308-3659330 TTGTCCTCACAGCCCCGTGCAGG + Intergenic
1050388318 9:5112350-5112372 TGCTCGCCCTAGCCCACTGCAGG - Intronic
1052035397 9:23674743-23674765 AGCTCCACACAGCTTCCTGCTGG + Intergenic
1053534103 9:38908709-38908731 TCCTCACCACAGCCCTGTGCGGG + Intergenic
1053819521 9:41952509-41952531 GAATCCCCACAGTCCCCTGCAGG - Intronic
1054109789 9:61096162-61096184 GAATCCCCACAGTCCCCTGCAGG - Intergenic
1054206327 9:62133128-62133150 TCCTCACCACAGCCCTGTGCGGG + Intergenic
1054456616 9:65434546-65434568 TCCACCCCACAGGCCCCTCCTGG + Intergenic
1054611068 9:67234963-67234985 GAATCCCCACAGTCCCCTGCAGG + Intergenic
1054632030 9:67455218-67455240 TCCTCACCACAGCCCTGTGCGGG - Intergenic
1054708168 9:68483952-68483974 GGCTCCCCACAGCAAACTGCTGG - Exonic
1055066346 9:72122872-72122894 TTCTCCCCACTCCCACCTGCTGG - Intronic
1056589111 9:87951402-87951424 TGGTTCCCACAGCCATCTGCTGG - Intergenic
1056665606 9:88578649-88578671 TGCTCCACACTGCCCCCTCGTGG + Intronic
1057176756 9:93005929-93005951 TCCACCCCACACCCCCCTGGTGG + Intronic
1057222872 9:93267294-93267316 TGTCCCCCACAACCTCCTGCTGG + Intronic
1057274440 9:93668830-93668852 GGCCCCCCTCAGCCCGCTGCAGG + Intronic
1058082507 9:100714798-100714820 TGGTCTCTACTGCCCCCTGCTGG - Intergenic
1058225091 9:102350392-102350414 TGCGCCCCCCAGCCCCCGACAGG - Intergenic
1058569421 9:106324714-106324736 TTCTCCCCACAGCCTCATGAAGG + Intergenic
1059414630 9:114155425-114155447 TGCCCCCTGCTGCCCCCTGCCGG - Intergenic
1059433819 9:114264912-114264934 TGCTTCCCACAGGGCCCTCCAGG + Exonic
1060401909 9:123354385-123354407 TGCTCCCCCCAGCCCCCCATTGG + Intergenic
1060468790 9:123930340-123930362 TGCACCCCACTGCGCCCCGCTGG + Intergenic
1061122305 9:128651090-128651112 TGGTCCCCACTGCACCCAGCAGG - Intronic
1061591721 9:131602224-131602246 TGCACTCCACAGCCACTTGCAGG - Intronic
1061823080 9:133239257-133239279 TGCTCACCAGCGCCCCCAGCTGG - Intergenic
1061884904 9:133586540-133586562 AGCTCCCCCCAGACCCCAGCTGG + Intergenic
1062001237 9:134216767-134216789 GGCCTCCCACAGCCCTCTGCGGG + Intergenic
1062152794 9:135030502-135030524 TGCTCCCCGCAACCCCGTACCGG + Intergenic
1062374618 9:136256305-136256327 TGCTGTCCTCAGCCACCTGCTGG + Intergenic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1062583605 9:137238927-137238949 TGCACCCCTCAGGCCGCTGCAGG + Intergenic
1189037116 X:37505097-37505119 GGGTCCCCACAGCCCACTTCCGG + Intronic
1189122261 X:38407391-38407413 TGCTCCCGAGATCCCCCTCCAGG - Intronic
1189354364 X:40299711-40299733 TCCTCCCCAAAGCCCCCGACAGG - Intergenic
1189355493 X:40307173-40307195 TTCTCCCCAGAGCCTCCTGAAGG + Intergenic
1189529605 X:41866018-41866040 TGCTCCCAACTGGCCCCAGCAGG - Intronic
1189599342 X:42605880-42605902 TGGTCCCCTAAGCCCCCTGTGGG - Intergenic
1192260799 X:69504995-69505017 TGCCCCGCACCGCCCCCAGCCGG + Intergenic
1195026449 X:100882298-100882320 TGCTCACCACAGCCCTGTGATGG - Intergenic
1195272960 X:103251114-103251136 TCCTCCGCACAGCCCCCAGAGGG - Intergenic
1197775780 X:130117910-130117932 ATCTCCCCACAGCCCGGTGCAGG + Intergenic
1199969925 X:152852192-152852214 TTCTCCACACATCCCCCTGCTGG - Intronic
1200073994 X:153542275-153542297 TTCTCCCCACCGCCTCCTCCCGG - Intronic
1200092230 X:153641419-153641441 TGATGCTCACAGCCTCCTGCCGG + Intergenic
1200103599 X:153700546-153700568 TGCTCCACCCACCCTCCTGCGGG + Exonic
1200163406 X:154020211-154020233 TGCTCTCCACTGCGGCCTGCAGG + Intergenic
1202174302 Y:22083573-22083595 TGTTTCCCACAGGCCACTGCAGG - Intronic
1202217058 Y:22502809-22502831 TGTTTCCCACAGGCCACTGCAGG + Intronic
1202326127 Y:23693261-23693283 TGTTTCCCACAGGCCACTGCAGG - Intergenic
1202544644 Y:25976793-25976815 TGTTTCCCACAGGCCACTGCAGG + Intergenic