ID: 1096573588

View in Genome Browser
Species Human (GRCh38)
Location 12:52539157-52539179
Sequence CTGGGACAAGGGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 584}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096573588 Original CRISPR CTGGGACAAGGGAGGGTAGA GGG (reversed) Intergenic
900124113 1:1062051-1062073 CGGGGACAAGGGAGGGAGGGAGG - Intergenic
900176121 1:1292167-1292189 CTAGGACAGAGAAGGGTAGAAGG + Intergenic
900213836 1:1470622-1470644 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
900221343 1:1511001-1511023 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901664095 1:10816788-10816810 CATGGACAAGGAAGGGTAGTGGG - Intergenic
901700184 1:11041144-11041166 TTGGTAGAAGGAAGGGTAGATGG + Intronic
901700195 1:11041201-11041223 TTGGTAGAAGGAAGGGTAGATGG + Intronic
902052230 1:13573039-13573061 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902689054 1:18098303-18098325 ATGGGACAGGGTAGGGGAGATGG + Intergenic
903513430 1:23893646-23893668 CTGGGACAAGAGAGAGTAGGTGG - Intronic
904488018 1:30840330-30840352 GTGGGAGATGTGAGGGTAGATGG + Intergenic
904645067 1:31959403-31959425 CTGGGGAAAGGGAGTCTAGATGG - Intergenic
904713558 1:32449541-32449563 CTTGGACAAGGGAGGGGAAAGGG + Intergenic
904938570 1:34149246-34149268 CGGGGAGCAGGCAGGGTAGAAGG - Intronic
904984869 1:34537095-34537117 CTGGGAAAAGGGAGCCGAGAAGG - Intergenic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906640086 1:47436686-47436708 CTGGGGCACGGAAGGGGAGATGG - Exonic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
908048096 1:60194415-60194437 ATGGGAAAAGGGAGGTTAAATGG + Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910327000 1:86020884-86020906 AGGGTACAAGGGAGGGTACACGG + Intronic
910604851 1:89072165-89072187 CTGGGACAATGGAGTCTAGTTGG + Intergenic
910807887 1:91206662-91206684 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
911130831 1:94386183-94386205 CTGGGCCATGGATGGGTAGAAGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912747584 1:112258238-112258260 CTGGGAGAAAGAAGAGTAGAAGG - Intergenic
913666420 1:121052503-121052525 GTGGCACCAGGAAGGGTAGATGG + Intergenic
914018105 1:143839615-143839637 GTGGCACCAGGAAGGGTAGATGG + Intergenic
914656719 1:149748148-149748170 GTGGCACCAGGAAGGGTAGATGG + Intergenic
914755320 1:150558896-150558918 CTGGCACAAGGGACAGTAGGGGG - Intronic
914833685 1:151189969-151189991 CTGGGAAAAGGGAGGGGAGGAGG - Intronic
915131390 1:153697843-153697865 CTGGGGCATGGGAGGCTACAGGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916448460 1:164895517-164895539 CAGGGACAAGGGAGGGTGTGAGG + Intronic
917436307 1:175024470-175024492 GTGGGACAAGGCACGGTGGATGG + Intergenic
917465458 1:175272034-175272056 CCTGGACAAGGGAAGCTAGAAGG + Intergenic
917683099 1:177387728-177387750 CAGAGACAAGGAAGGGTAGTGGG - Intergenic
920439802 1:205972435-205972457 CTGTGATAAGGGAGAGTAGGGGG + Intergenic
921281316 1:213570816-213570838 CGGTGACAAGGAAGAGTAGATGG - Intergenic
921673886 1:217955827-217955849 GTGGGACAAGGATGGTTAGAGGG - Intergenic
921734572 1:218612365-218612387 CTGGGACATGGGTGAGTGGATGG + Intergenic
922276822 1:224086877-224086899 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
922559493 1:226558864-226558886 CTGGGGCAGGGTAGGGTAGCAGG + Intronic
922902179 1:229145830-229145852 CTGAGACAAGCCAGGGAAGAAGG + Intergenic
922974008 1:229768752-229768774 CTGGGCCAAGGGAAGGCAGGTGG + Intergenic
1064224045 10:13466970-13466992 CTGGGAGAAGGAAGGGTGAAGGG + Intronic
1064756697 10:18577956-18577978 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1064773766 10:18752806-18752828 CTTGGACAAGGGAGGGGAAAGGG - Intergenic
1064827361 10:19420093-19420115 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065810560 10:29438982-29439004 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1065888473 10:30100091-30100113 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1067979248 10:51064893-51064915 CAAGAACAAGGGAGGGGAGATGG + Intronic
1068985155 10:63101421-63101443 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1069616833 10:69811557-69811579 CTGTGACATGGGAGGTCAGAGGG + Intronic
1069733453 10:70634608-70634630 CTTGGACAAGGGAGGGGGAAGGG + Intergenic
1069777400 10:70934992-70935014 CCTGGGCAAGGAAGGGTAGAGGG + Intergenic
1069869653 10:71525526-71525548 CCAGGACTAGGGAGGGTAGCTGG + Intronic
1070470284 10:76772598-76772620 CTGGGAGCAGAGAGGATAGAAGG + Intergenic
1070724294 10:78777832-78777854 CTGGGACGAGGGGAGGTGGATGG - Intergenic
1070765659 10:79054694-79054716 CTGGGATAAGGGCTGATAGAAGG + Intergenic
1071282762 10:84117541-84117563 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1071283867 10:84126317-84126339 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1071525689 10:86356826-86356848 CTGGGAAGAGGCAGGGCAGAAGG + Intronic
1071974381 10:90940215-90940237 CTGGGTCAGGGTAGGGAAGAGGG - Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1073288129 10:102400527-102400549 CGGGGACCAGGGAGGGTATCTGG + Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074580540 10:114714909-114714931 ATGGGACAAGGGAGAGAAGAAGG - Intergenic
1075345764 10:121680988-121681010 CTGGGATAGGGGAGGAGAGAAGG + Intergenic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1076108988 10:127846650-127846672 CTGGGAGAAGGGAGGTGGGATGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1077079842 11:720358-720380 ATGGGACAAGGGTGGGCAGAGGG + Intronic
1077374685 11:2199995-2200017 CTGGGACACGGGTGGGGAGGGGG - Intergenic
1077644600 11:3912206-3912228 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1077937480 11:6802832-6802854 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1078211641 11:9274783-9274805 CTGAGACAGGGTAGGGTAGCTGG + Intergenic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1079271212 11:18987592-18987614 CTTGGACAAGGGAGGGAAACAGG + Intergenic
1079279798 11:19076899-19076921 CTGGGGCAGGGGAGAGGAGATGG - Intergenic
1081194089 11:40140038-40140060 CAGGGACAAGGGAGAGAAGAAGG + Intronic
1081345388 11:41979342-41979364 CTTGGACAAGGGAGGGGAACGGG - Intergenic
1082024875 11:47564981-47565003 CTAGGACAGGGGAGGGGAGGAGG + Intronic
1083550957 11:63589943-63589965 TTGGGACAAGGGTGGGGACAAGG - Intronic
1083588787 11:63879969-63879991 CTGGGACTAGGGGGTCTAGAAGG + Intronic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083742218 11:64716981-64717003 CTGGGAGAAGGGTGGGTTGGAGG - Intronic
1083943691 11:65912184-65912206 CTGGGACACGGGTGTGTACAAGG + Intergenic
1084631157 11:70351823-70351845 CTGAGACAAGTAAGGCTAGATGG - Intronic
1084671591 11:70610037-70610059 CAGGGACCAGGGAGGGGTGAGGG + Intronic
1084748587 11:71189132-71189154 CTGGAACAAGGGGAGGGAGAGGG - Intronic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084892931 11:72245251-72245273 TCGGGACAAGTCAGGGTAGAGGG - Intronic
1085042057 11:73332276-73332298 CCTGGACAAAGGTGGGTAGAGGG - Intronic
1085334311 11:75679256-75679278 CTGGGAGATGGGAGGCCAGAAGG + Intergenic
1085544018 11:77300311-77300333 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1086154312 11:83648822-83648844 TTGGGAAAAGGCAGGGTGGAAGG + Intronic
1086510792 11:87555695-87555717 CTTGGACAAGGGAGGGGAAGTGG + Intergenic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087456572 11:98394484-98394506 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087666662 11:101057156-101057178 AGGAGACAAGGGAGGGTACAGGG + Intronic
1087917050 11:103823171-103823193 CTGGGAGTAGAGAAGGTAGAAGG + Intergenic
1089650794 11:119911495-119911517 GTGGGACTGGGGAGGGCAGATGG - Intergenic
1090202574 11:124866723-124866745 CTGAGACCGGGAAGGGTAGAGGG + Intronic
1090618978 11:128544482-128544504 CTGGGAGAAGGCAGGGGTGAGGG - Intronic
1091319544 11:134640023-134640045 CCTGGAGAAGGCAGGGTAGAGGG + Intergenic
1091384058 12:80994-81016 TTGGGGCATGGGAGGGTAGGAGG + Intronic
1091786524 12:3246360-3246382 CTGGGAAAAGGTGGGGAAGAGGG - Intronic
1091841467 12:3624290-3624312 CCTGGAGAAGGGAGGGTGGAGGG - Intronic
1091922809 12:4319624-4319646 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1093356355 12:18173014-18173036 CTTGGGCAAGGGAGGGGAAAGGG - Intronic
1093357003 12:18178402-18178424 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1093950500 12:25160641-25160663 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1094583831 12:31758717-31758739 CTTGGACAAGGAAGGGGAGGGGG - Intergenic
1096550826 12:52370517-52370539 TTAGGACAAGAGAGTGTAGAAGG - Intergenic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1096646669 12:53041995-53042017 GGGGGACAAGGTAGGGGAGAGGG - Exonic
1097022098 12:56027689-56027711 CTTGGGCAAGGTAGGGCAGAGGG + Intronic
1097198251 12:57256441-57256463 ATGGAGCAAGGGAGGGCAGATGG + Exonic
1097218295 12:57430886-57430908 CTGGGACGGGGGAGGGGAAAGGG + Exonic
1097715994 12:62966757-62966779 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1097757193 12:63419537-63419559 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1100695554 12:97089020-97089042 GTGGGAGGAGTGAGGGTAGAGGG - Intergenic
1100716861 12:97315151-97315173 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1100985563 12:100199427-100199449 CTTGGAGAAAGGAGGGTGGATGG + Intronic
1101855967 12:108443241-108443263 CTTGGACAAGGGAGGAGATATGG - Intergenic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1103190831 12:119000604-119000626 CTGGGAAAAGTGAGGGCAAAAGG + Intronic
1103356874 12:120328098-120328120 CTGGGATAAGGGAGACAAGAAGG + Intergenic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1104544411 12:129698552-129698574 AGGGGAGAAGGGAGGGGAGAAGG + Intronic
1104544417 12:129698564-129698586 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1105308662 13:19187260-19187282 GTGGGACAAGGAGGGGGAGATGG + Exonic
1105569076 13:21582840-21582862 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1105569684 13:21589895-21589917 CTTGGACAAGGGAGGGAAAGAGG - Intronic
1106201923 13:27545286-27545308 CTGGAGCAAGGGAGGGTAAATGG + Intergenic
1107438492 13:40403309-40403331 CTGGGACCAGGAAGGGTGGGAGG - Intergenic
1107764987 13:43724977-43724999 CTGGGACAAGGGGAGAGAGAGGG + Intronic
1108379886 13:49845633-49845655 CTGGGAAAAGGGAGCTTAGCTGG + Intergenic
1108728478 13:53206945-53206967 CTGGGAAATGTGAGGGTAAAGGG - Intergenic
1111285090 13:86080282-86080304 ATGGGAGAAGGTAAGGTAGAGGG - Intergenic
1111332344 13:86776175-86776197 GTGGGACAAGGGAGAGTATCAGG - Intergenic
1111766711 13:92539704-92539726 CTGGGGCAAAGGAGGCTATAAGG - Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112217607 13:97449543-97449565 GTGGGGCAAGGGAGAGTGGATGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112477045 13:99740913-99740935 CAGGGACAAGGGATGGTGCAGGG + Intronic
1112538853 13:100286295-100286317 CTCGGACAAGGGAGGGGAAGGGG + Intronic
1112773489 13:102818616-102818638 CTAGGACTAGGAAGGATAGATGG + Intronic
1113535071 13:111059524-111059546 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1113885162 13:113655034-113655056 CTGGAACTAGGTAGGGAAGATGG - Intronic
1114235822 14:20822848-20822870 CTTGGACAAGGGAGGGAAAGGGG + Intergenic
1114705959 14:24726828-24726850 CTGGAGCCAGGGAGGCTAGATGG + Intergenic
1114717286 14:24840464-24840486 CTGGGACAAGCAAGGCAAGAAGG - Intronic
1115089301 14:29554708-29554730 ATGAGACAAGGGAGGGATGAAGG + Intergenic
1115210830 14:30966238-30966260 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1115211626 14:30972412-30972434 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1117043678 14:51791076-51791098 CTGGGACAAAGAAGTGTAGGAGG + Intergenic
1117179281 14:53175887-53175909 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1117179955 14:53181516-53181538 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1117517917 14:56520861-56520883 CTGGGACAAGGGGCAGAAGAGGG - Intronic
1119252828 14:73171548-73171570 TTTGGACAAGGGAGGGGAAAGGG + Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119645076 14:76342045-76342067 TTGGGACATGGGAGGGCAGGTGG + Intronic
1119935150 14:78585506-78585528 TAGGGACAAGGGAGGGTGGAGGG + Intronic
1120768619 14:88354926-88354948 ATGGGTGAAGGAAGGGTAGATGG - Intergenic
1121133058 14:91467021-91467043 CTAAGACAAGGGAATGTAGATGG + Intronic
1121318206 14:92974676-92974698 GTGGGACAAGGGAGGAGAGAAGG + Intronic
1121353886 14:93196822-93196844 CTGGGAAGAGGGAGGGGAGTAGG - Intronic
1121453301 14:94023006-94023028 CTGGGGCAAGGGAGGAGTGAGGG + Intergenic
1121596241 14:95165381-95165403 ATTGGACAATGGAGGGAAGATGG - Intergenic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1124867188 15:33503993-33504015 CTGGGATAAGAGAGGGGAGTAGG - Intronic
1124888370 15:33708795-33708817 CTTGGACAAAGGAGGGGAGGGGG + Intronic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1125333429 15:38604402-38604424 CTGGGACAAGTGAGGATAAGCGG - Intergenic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1127144615 15:56011418-56011440 CTGGCACAGGGGAGGGTACTAGG - Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127687719 15:61364950-61364972 CTGGAGCCAGGGAGGCTAGACGG - Intergenic
1128498506 15:68211394-68211416 CTGGGAGAAGGGTGGTCAGAGGG - Intronic
1128815204 15:70603129-70603151 CTGGGACAGGACAGGGTTGAGGG + Intergenic
1128927193 15:71668457-71668479 CAGGTAAAAGGGAGGGGAGAAGG + Intronic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129506044 15:76082388-76082410 GTGGTAGAAGGGAGGGAAGAAGG + Intronic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1130080972 15:80733180-80733202 CGGGGACAGGGGAGGGAAGGTGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130446016 15:84002667-84002689 CGGGGAACAGGTAGGGTAGAAGG - Intronic
1130901761 15:88212620-88212642 CTGGGAGAAGGGAGGGTCAGAGG - Intronic
1131008284 15:88996390-88996412 CGGGGGCAAGGGAAGGGAGAGGG - Intergenic
1131185473 15:90270397-90270419 CTGGCAGAAGGGAGGAGAGAAGG - Intronic
1131422574 15:92319618-92319640 CTGGGAAAAGGGAGGGGACAGGG - Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131770497 15:95731848-95731870 CTGGGACAAGGTGGTGAAGATGG + Intergenic
1132005883 15:98226542-98226564 CTGGTACAAAGGAAGGCAGAAGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1133061452 16:3177466-3177488 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1133596092 16:7294224-7294246 GTGGGACAAGGAAGGGTAGGCGG - Intronic
1134065082 16:11223191-11223213 CTGGGACAAGGGCGGTTGGGCGG + Intergenic
1134445868 16:14331122-14331144 CTGGGACAAGCCTGGGTAGCAGG + Intergenic
1135169248 16:20168730-20168752 CTGGGAGAAGGGAGGGTGAAGGG - Intergenic
1135210052 16:20517849-20517871 GAGGGACTATGGAGGGTAGAGGG - Intergenic
1135263453 16:21000970-21000992 CTGGGACAAGGGAGACAAGTTGG - Intronic
1135607471 16:23836526-23836548 CTGGGACCAGGGTGGGGACAGGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136395518 16:29990717-29990739 CTGGGGCAGGGGAGGATAGTGGG + Intronic
1137017863 16:35394362-35394384 TTGGGACAGCGGAGGGTGGAGGG - Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1138200466 16:55084520-55084542 GTGGAACAAGGAAGGGAAGAAGG - Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138489846 16:57370399-57370421 CTGGACCTGGGGAGGGTAGAGGG + Intergenic
1138800750 16:60025636-60025658 TTGGGAAAAGTGAGGGTAAAAGG + Intergenic
1139357912 16:66378267-66378289 CTGGGACAAGGGAAGTCAGGAGG + Intronic
1139428148 16:66895796-66895818 CTGGGACAGGGGAGGACAGATGG - Intergenic
1140114220 16:72027532-72027554 CTGGGACCAAGGATGGTGGAAGG + Intronic
1140948850 16:79796639-79796661 AAGGGAAAAGGGAGGGTTGAGGG + Intergenic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1142787049 17:2232570-2232592 GTGGGACAAGGGACGTTTGAGGG - Intronic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1144155139 17:12492997-12493019 CAGAGACAAGGGAGGGGAGCTGG + Intergenic
1144244273 17:13347487-13347509 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1144781989 17:17812986-17813008 CTGAGACTAGGGTGGGGAGAGGG - Intronic
1145891076 17:28416184-28416206 CTGGGCCCATGGAGGGTAGCTGG - Intergenic
1146200136 17:30850297-30850319 GTGGGAGAGGGGAGGGGAGAGGG - Intronic
1146910523 17:36645601-36645623 CTGGGTTAAGGGAGGATAAAGGG + Intergenic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1148127034 17:45242263-45242285 CTGGGCCCAGGGAGGGCTGATGG - Intronic
1148862907 17:50613868-50613890 CTGGGGCAAGGGAGGACAGGAGG - Intronic
1149639502 17:58193639-58193661 CTGGGAGGAGAGAGGGTAAAGGG + Intronic
1150726030 17:67652358-67652380 CTGGGACAAGGCAGAGCAAAGGG - Intronic
1150824367 17:68461731-68461753 CTGGGACAATGGAGCCAAGAGGG + Intergenic
1151041548 17:70866734-70866756 CTGGTACATGGGTGGGGAGAGGG + Intergenic
1151349617 17:73524119-73524141 CTGGGGCCAGGGAGGGCAAATGG - Intronic
1151540419 17:74761986-74762008 CAGGGACAGGGGAGGGTCCATGG - Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151969576 17:77450826-77450848 CTGGGACCATGGAAGGGAGAAGG - Intronic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152576762 17:81144503-81144525 CTGGGACAATGGAGGGGCAAGGG + Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1153169840 18:2303238-2303260 TTTGGACAAGGGAGGGGAGGGGG - Intergenic
1153826870 18:8882920-8882942 CTTGGACAAGGGAGGGGAAGAGG + Intergenic
1154025007 18:10698830-10698852 CTGGGGCAAGGGAGTGTATTGGG - Intronic
1155407085 18:25500914-25500936 CTGGAACAAGGAAGTGGAGATGG + Intergenic
1155746620 18:29362280-29362302 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1156488104 18:37479333-37479355 CCGGGCCTAGGGTGGGTAGAAGG - Intronic
1157002936 18:43549142-43549164 CTGGAAGAAGGGAGGAGAGAAGG + Intergenic
1157085207 18:44573436-44573458 AAGGGAGAATGGAGGGTAGAAGG + Intergenic
1157171386 18:45409633-45409655 CTGGGAAAGGGGTGGGTAGGAGG - Intronic
1157562359 18:48657480-48657502 CTGAGAGAAGGGAGGGTTGGTGG - Intronic
1157822909 18:50786992-50787014 GTGGGACAAGGGAGTCTATAAGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1159535046 18:69704835-69704857 CTTGGGCCAGGGTGGGTAGAGGG - Intronic
1160517943 18:79488797-79488819 CTGGGACAAGGCATGGCAGGTGG - Intronic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161341061 19:3742560-3742582 CCGGGACAGGGGTGGGTGGATGG + Intronic
1161398876 19:4058977-4058999 CTGGGAGCAGGGAGGGTAGGAGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161649816 19:5477677-5477699 CTGAGCCAAGGGAGGGTACAGGG + Intergenic
1162345399 19:10115432-10115454 CTGGGACAAGGCAGGGAGCAGGG + Intronic
1163000169 19:14362230-14362252 CTGGGCCAAGGGGGAGTTGATGG + Intergenic
1163215558 19:15874145-15874167 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1163828326 19:19535913-19535935 CTGGGCCAGGGGTGGGCAGAGGG - Exonic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164484189 19:28640712-28640734 GTGAGACAAGGCAGGGGAGAGGG - Intergenic
1164655418 19:29917647-29917669 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1164890794 19:31821487-31821509 GAGGTACAAGGGAGGGGAGATGG - Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166154386 19:40899948-40899970 CAGGCACAGGGGAGGGCAGAAGG - Intergenic
1167175320 19:47860633-47860655 CCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1167307005 19:48715145-48715167 CTGGGAGAAGAGAGGGTTGGGGG + Intronic
1167766319 19:51485137-51485159 CTGGGACAAGGGTGGGATGTTGG + Intronic
1167767959 19:51496834-51496856 CTGGGAGAAAGCAGGGGAGAAGG + Intronic
1168011000 19:53532238-53532260 CTGGGACAGGGGTGGGAATAGGG - Intronic
1168115424 19:54219563-54219585 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168121253 19:54253785-54253807 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168181551 19:54665464-54665486 CTGGGGCAGGGGAGGGGAGCAGG + Intronic
925200608 2:1965246-1965268 CAGGGACCAGGCAGGGAAGAGGG + Intronic
925652173 2:6103092-6103114 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
926106272 2:10153871-10153893 CAGGGACTGGGGAGGGGAGAAGG + Intronic
926249765 2:11147912-11147934 CCAGAACAAGGGAGGGTGGATGG + Intergenic
926329764 2:11814740-11814762 CTGGGACCAGGGGGAGTACAAGG + Intronic
927326438 2:21810927-21810949 CAGGAACAAGGCAGGGGAGAAGG - Intergenic
927416774 2:22888371-22888393 CTGGGACAAGGGGCTGTTGAAGG + Intergenic
927575532 2:24199147-24199169 CTTGGACAAGGGAGGAGAAAGGG + Intronic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928439918 2:31283864-31283886 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
929097258 2:38275352-38275374 CTGAGGCAAGGGATGGGAGATGG - Intergenic
931363493 2:61598527-61598549 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
931799654 2:65746479-65746501 CTTGGACAGGGGAGAGCAGAAGG + Intergenic
932005193 2:67920479-67920501 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
933766701 2:85714143-85714165 CTGGGACAGAGGAGGCTACAAGG + Intergenic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
934916013 2:98301599-98301621 CTGGCACTGGGGAGTGTAGAAGG - Intronic
935047669 2:99497026-99497048 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
935225269 2:101047249-101047271 CTGGGAGCAGGGAGGGTAGGGGG - Intronic
935596129 2:104879393-104879415 CTGTCACAGGGGAGGGTACATGG + Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937475140 2:122208557-122208579 CTGGGATAAGGGAAGAGAGAGGG - Intergenic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
938920178 2:135987671-135987693 CTGGAACATGAGAGGGTGGAAGG + Intergenic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
940802251 2:158145580-158145602 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941701939 2:168613086-168613108 CTGGGATAAAGGGGGGTTGAAGG + Intronic
941876040 2:170434427-170434449 CTTGGACAAGGGAGGGGAAGGGG + Intronic
942243401 2:173984940-173984962 CTAGGACAATGGAGGTTATAAGG - Intergenic
942496384 2:176544518-176544540 CTGGGTCATGGGAAGGAAGAGGG - Intergenic
942949076 2:181702489-181702511 GTGGGAGAAGTGAGGGGAGAGGG - Intergenic
943154222 2:184152212-184152234 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
944108071 2:196101040-196101062 CTGGCACAAGGAAGGATGGATGG - Intergenic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
945720497 2:213412340-213412362 CTTGGACAAGGGAGGGGAAGGGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946298069 2:218802228-218802250 CTTGGACAAGGGAGGGGAAGGGG - Intronic
946421112 2:219565383-219565405 CTGGTACAAGGATGGGCAGAAGG - Exonic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
946856198 2:223952200-223952222 GTGGGACATTGGAAGGTAGAAGG + Intergenic
947134891 2:226967525-226967547 GTGGGATAAGGGAGGGGGGAGGG - Intronic
947556826 2:231100295-231100317 CTTGGACAAGGGAGGGGAAGGGG + Intronic
947729740 2:232421168-232421190 CCGGGACTAGTGAGGGTAGCGGG + Intergenic
947814543 2:233027521-233027543 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
1168933539 20:1644396-1644418 CTGGAGCCAGGGAGGCTAGATGG - Intronic
1169080496 20:2795470-2795492 CTCAGAGAAGGGAGGGTAGCGGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169519641 20:6356949-6356971 GTGGAAGAAGGGAGGGTACATGG - Intergenic
1169835548 20:9873824-9873846 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170663263 20:18363123-18363145 CTGAGACCAGTGAGGGCAGATGG + Intergenic
1171456631 20:25276146-25276168 CTGGGAACATGGAGGGTAGCAGG + Intronic
1172806422 20:37615232-37615254 CTGGGACAATTGAGGGGAAAGGG - Intergenic
1172940705 20:38652338-38652360 GTGGGATGAGGGAGGGAAGAGGG - Intergenic
1173640950 20:44601453-44601475 CTGGGAAAAGGGAGGGCTGCCGG - Intronic
1173664443 20:44754599-44754621 CGGGGACAAGGGAAGGAAGGGGG + Intronic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1174141406 20:48416782-48416804 GTGGGAGAAGGGACGGTAGAAGG - Intergenic
1174509106 20:51037676-51037698 CTGGGGCGAGGGAGGACAGATGG + Intergenic
1175564070 20:59958868-59958890 CTAGGCTAAGGGAGGGGAGAGGG + Intronic
1175892799 20:62322882-62322904 CTGGGACACGAGTGGGTAGCCGG - Intronic
1175984229 20:62755924-62755946 ATGGAACAAGGGAGGGAAGGAGG - Intronic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176192607 20:63819539-63819561 TTGGGAGAAGGGAGGGTAGGAGG - Intronic
1178824006 21:36000098-36000120 CTGGTAAAAGGAAGGGGAGAGGG + Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179034918 21:37751403-37751425 CTGGGACCAGGGAGAGCAAACGG + Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179970994 21:44836443-44836465 CTGGGACAGGGGTGGGGACAGGG - Intergenic
1180044947 21:45301055-45301077 CTGGGACAGGTGAGGGTGTAGGG - Intergenic
1180210932 21:46295303-46295325 GGAGGACAAGGCAGGGTAGATGG - Intronic
1180706101 22:17810858-17810880 CTGGGACAGGGGTGGGCAGCAGG + Intronic
1180865913 22:19119812-19119834 CTGGTACAGGGCAGGGTGGAAGG - Intronic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181313345 22:21957201-21957223 CAGGGAGAAGGCAGGGTCGAGGG - Exonic
1181346450 22:22223273-22223295 CAGGGAGAAGGCAGGGTCGAGGG - Intergenic
1181752100 22:24996037-24996059 CTGGGAGAAGTGAGGGCAGGTGG + Intronic
1181820894 22:25474815-25474837 CAGCGACTAGGAAGGGTAGATGG + Intergenic
1182078617 22:27512695-27512717 CTGGGACAGGGGAGGGTTGTTGG - Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1183034908 22:35134232-35134254 GTGGGACTGGGGAGGGTGGAGGG - Intergenic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184817324 22:46882017-46882039 CTGGGACAATGGTGGGTACTGGG + Intronic
1184851001 22:47120570-47120592 CTGGCAGAGGGCAGGGTAGAAGG + Intronic
1185206003 22:49539109-49539131 CTTGGACAATTGAGGGTTGACGG + Intronic
949382818 3:3464990-3465012 GGGAGACAAGGGAGGGAAGAGGG + Intergenic
949610739 3:5700979-5701001 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
949611605 3:5708635-5708657 CTTGGACAAGGGAGGGGAATGGG + Intergenic
949787381 3:7757033-7757055 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
949944654 3:9180411-9180433 GTGGGACAAGAGAGGGTAAGGGG - Intronic
950719802 3:14874924-14874946 CCAGGACAAGCGAGGGGAGAAGG - Intronic
950765751 3:15271941-15271963 GTGGGACGAGGGAGGGTGGTGGG - Intronic
951329097 3:21343729-21343751 CTTGGACAAGGCATGCTAGATGG + Intergenic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951918654 3:27828981-27829003 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952519755 3:34144963-34144985 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952782150 3:37111894-37111916 TTGGTACAAGGGAGGAGAGAAGG - Intronic
953710471 3:45265509-45265531 CTGGGACAAGGGTTGGGATATGG + Intergenic
953828746 3:46277323-46277345 CTGGGACAAGTGAGGATGGATGG + Intergenic
954130711 3:48559334-48559356 CAGGGCCATGGGAGGGGAGATGG - Intronic
954389578 3:50261577-50261599 CTGGGACAGGGGGTGGTACAGGG - Intergenic
954519607 3:51212946-51212968 CTGGGCCAAGGGAGGAAATACGG - Intronic
954604350 3:51897288-51897310 CTTGGACAAGGGAGGGGAAGGGG - Intronic
954605014 3:51902756-51902778 CTTGGACAAGGGAGGGGAAGGGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
955843370 3:63135739-63135761 CAGGGACAAAAGAGGGTAGAGGG + Intergenic
956589060 3:70894385-70894407 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
956630823 3:71315026-71315048 CTGGGATAAGGCTGGGTAAAAGG + Intronic
957975160 3:87433779-87433801 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958796660 3:98713370-98713392 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
959562913 3:107802874-107802896 CGGGGACTAGGGTGGGGAGAAGG - Intronic
959644510 3:108682600-108682622 CAGAGACTAGGGAGGATAGATGG + Intronic
959646701 3:108711611-108711633 CTGGGAACAGGGAGGGCACAGGG + Intergenic
960345980 3:116533638-116533660 TGGGGAGAAGGGAGGGGAGAGGG + Intronic
960720068 3:120616859-120616881 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
960720894 3:120623429-120623451 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
960844562 3:121994141-121994163 TTGGGATAGGGGAGGGCAGAGGG - Intronic
961384381 3:126515932-126515954 GGGGGACAAGGGAGGGTAGGTGG - Intronic
961584141 3:127908432-127908454 ATGGGAGAAGGGAGGGGAGGGGG - Intergenic
962562217 3:136618344-136618366 CTTGGACAAGGGAGGGGAAGGGG - Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963524764 3:146404137-146404159 CTTGGACAAGGGAGGGAAAGGGG - Intronic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
965032386 3:163389229-163389251 CTGGGAGAACGGAGAATAGAAGG - Intergenic
966043674 3:175523626-175523648 CTTGGACAAGGGAGGGAAAGGGG + Intronic
966306540 3:178542078-178542100 CTTGGACAAGGGAGGGGAAGGGG - Intronic
966404816 3:179585607-179585629 ATGGGATATGGGTGGGTAGAAGG - Intronic
967440183 3:189498484-189498506 CAGGCACAAGGGAGTGGAGAAGG + Intergenic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
968854838 4:3111947-3111969 TGGGGACAGGGGAGGGTAGGAGG - Intronic
969111886 4:4849485-4849507 CTGGGACAGGAGAAGCTAGAGGG + Intergenic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
970092430 4:12425834-12425856 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
970093071 4:12431240-12431262 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
970124161 4:12790666-12790688 GTGGGAGAAGGGAGAGTAGCAGG - Intergenic
971236114 4:24843913-24843935 TTCGGACAAGGGAGGGAAGCCGG - Intronic
972784415 4:42313821-42313843 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973646115 4:52952820-52952842 CTGGGAAAAGGTGGGGGAGAAGG - Intronic
974446265 4:61986664-61986686 CAAAGAAAAGGGAGGGTAGATGG + Intronic
975204920 4:71634512-71634534 CTTGGACAACGGAGGGGAAACGG + Intergenic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
975911982 4:79277833-79277855 CTTGGACAAGGGAGGGGAAGGGG - Intronic
976038188 4:80849705-80849727 CAGAGGCTAGGGAGGGTAGAGGG + Intronic
979542791 4:121905273-121905295 CTGGGCCAAGGGTAGGGAGAAGG + Intronic
979770704 4:124521596-124521618 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
982823915 4:159978272-159978294 CTTGGACAAGGGAGGGAAAGAGG - Intergenic
984133343 4:175905536-175905558 CTGGCACAAGAGAAGGGAGAAGG + Intronic
986730412 5:10631193-10631215 CTGAGACATGGGAGGGCAGGAGG + Intronic
986813749 5:11385647-11385669 CTGGGGCAAGGGTGGGGAGTGGG - Intronic
988969703 5:36454789-36454811 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
990251024 5:53915134-53915156 CAAGGACAAGGGAGGGAAGGAGG - Intronic
990395071 5:55369509-55369531 CTGGTACAGTGGAGGATAGAGGG + Intronic
991159443 5:63480032-63480054 GTAGGACAAAGGAGGGTAAAGGG + Intergenic
991486867 5:67145985-67146007 CTGGGACTAAGGAGGGGAAAGGG + Intronic
992068209 5:73126375-73126397 CTTGGAGAAGGAAGGGGAGATGG + Intronic
992772318 5:80060046-80060068 CTGAGACAAGGGATGGCGGAAGG + Intronic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995092391 5:108193542-108193564 GTTGGACAAGGGAGGGAACAAGG + Intronic
995731614 5:115249390-115249412 CTTGGACAAGGGAGGGGAAGGGG + Intronic
995794811 5:115930076-115930098 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
997528240 5:134567075-134567097 CCGGGCCAGGGCAGGGTAGATGG + Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997754952 5:136387376-136387398 CTTGGACAAGGGAGGGGAACGGG - Intronic
997852738 5:137347101-137347123 TTGGTGCAAGGGAGGGTGGAGGG - Intronic
998173197 5:139884320-139884342 CAGGGACAAGTGAGGGGAGGAGG + Intronic
998203661 5:140144560-140144582 CCGGGTCATGGCAGGGTAGAGGG - Intergenic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
998939125 5:147261330-147261352 CTTGGACAAGGGAGGGGAAGGGG + Intronic
999118593 5:149187931-149187953 CTTGGACAAGGGAGGGGAAGAGG - Intronic
1000987381 5:167875593-167875615 CTGGGACAATGGGGAGTAGATGG + Intronic
1001355918 5:171022625-171022647 CTGGGACCAGGGAGGCTGGAAGG - Intronic
1001558230 5:172650738-172650760 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1001855551 5:175007549-175007571 AAGGGAAAAGGGAGGGAAGAAGG - Intergenic
1002450319 5:179314966-179314988 CTGGGAGAAGGGGGCGTAGCTGG - Intronic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003982996 6:11407040-11407062 CTGGCACCAGGGAGGAAAGAAGG - Intergenic
1004653077 6:17630742-17630764 AGGGGAGAAGGGAGGGGAGAGGG + Intronic
1005316385 6:24606541-24606563 CATGGACAAGGGAGGGATGAAGG + Intronic
1006072501 6:31507632-31507654 CTGGGACAGGGGATGGAAGCTGG + Intronic
1006326211 6:33355901-33355923 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1006385133 6:33726614-33726636 CGGGGCCAATGGAGGGTAGCAGG - Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1006909079 6:37552367-37552389 CAGGGCCCACGGAGGGTAGAGGG + Intergenic
1007164979 6:39822830-39822852 CTGGGACAGGGAAGGGTCCAGGG + Intronic
1008104938 6:47431097-47431119 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1008280196 6:49587327-49587349 CTAGGACAAGGGAGGGGAAGGGG + Intergenic
1008340709 6:50360537-50360559 CTTGGATGAGGGAGGGTGGAAGG + Intergenic
1008362335 6:50635541-50635563 AGGGGAGAAGGGAGGGGAGAAGG + Intergenic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1009635389 6:66259029-66259051 CTTGGACAAGGGAGGGGAAGAGG - Intergenic
1009636010 6:66264705-66264727 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1010949429 6:82017495-82017517 CTGGGAGAAGGGAGGGCTCAGGG + Intergenic
1011123163 6:83977205-83977227 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1011345538 6:86366040-86366062 CTGGGACAAGAGAGGGTTCAGGG - Intergenic
1011885557 6:92090628-92090650 CTGGGGCAAGGGTGGCCAGAAGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1013612972 6:111812261-111812283 CTGGGAGGAGGCAGGGCAGATGG + Intronic
1013814586 6:114082944-114082966 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1014780461 6:125559299-125559321 CTGGGACATAGGACAGTAGAAGG - Intergenic
1015514195 6:134068630-134068652 CTGGGACAAGGGAGGAGGGTGGG + Intergenic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1015822933 6:137282196-137282218 CTGGAATAAGGGAGGTTACATGG + Intergenic
1015909969 6:138160977-138160999 TTAGGCCAAGGGTGGGTAGAAGG - Intergenic
1017133487 6:151128382-151128404 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1017177976 6:151522638-151522660 CTTGGACAAGGGAGGGTAAGGGG - Intronic
1017247291 6:152240127-152240149 CCAGGACAAGGGAGGGCAGAGGG + Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018163722 6:161074096-161074118 GTGGGACTAGGCATGGTAGATGG + Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020121576 7:5507002-5507024 CGGGGACAAAGGAAGGCAGAAGG + Intronic
1022044626 7:26612979-26613001 CTGGGACAAGGTAGAGAGGAGGG + Intergenic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022469784 7:30675098-30675120 CTGGGGCAAGGGAGAGTGGGAGG - Intronic
1023371749 7:39518849-39518871 ATGAGACAAGGGAGAGAAGAAGG - Intergenic
1023436796 7:40147952-40147974 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1023780416 7:43650189-43650211 CTGGGACAGGGGTGGGCAGATGG + Exonic
1023798081 7:43810504-43810526 CCTGGACAAGGGAGGGGAAAGGG - Intergenic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1024810665 7:53207631-53207653 CTGGGATAAGAGATGGCAGATGG + Intergenic
1026144501 7:67734808-67734830 CTGGGGGAAGGCAGTGTAGAAGG - Intergenic
1026790051 7:73325609-73325631 CTGGGAAAGGGGAGGAGAGAAGG - Intronic
1026799254 7:73388501-73388523 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1028052859 7:86207108-86207130 CTGGGGCAACTGAGGGTAGCTGG - Intergenic
1028133996 7:87207664-87207686 GAGGGAGAAGGCAGGGTAGAGGG + Intronic
1028333449 7:89624475-89624497 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1029162650 7:98563553-98563575 AGGGGACATGGGAGGGTACAAGG + Intergenic
1029221828 7:98996008-98996030 ATGGGACAGGGGTGAGTAGATGG - Intronic
1029956880 7:104649544-104649566 CTGGGACAAAGGAGGGGAGCAGG + Intronic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031975442 7:128090661-128090683 CTGGGAGAAGGGAGAGCAGTGGG - Intronic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032697203 7:134347740-134347762 CTGGGACATGGATGGGTGGATGG + Intergenic
1032705992 7:134421762-134421784 CTGGCCCAATGAAGGGTAGAGGG + Intergenic
1033096795 7:138439289-138439311 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033270538 7:139929264-139929286 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1033383160 7:140844141-140844163 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1036213938 8:6863655-6863677 CGGGGACAAGGGAGGCTGGCGGG + Intergenic
1037412722 8:18615412-18615434 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1038073138 8:24040291-24040313 CTGGGAGATGAGAGGATAGAAGG - Intergenic
1038483066 8:27914916-27914938 CTGGGATCAGGGAAGGGAGAAGG - Intronic
1039286269 8:36044153-36044175 TGGGGACAAGGGAGGTGAGAAGG + Intergenic
1041417062 8:57622472-57622494 CAGAGACAAGGGTAGGTAGAGGG + Intergenic
1041524068 8:58786430-58786452 CTGGAAATAGGGAAGGTAGAGGG - Intergenic
1042750664 8:72154292-72154314 CTGGGACATGGAAGGCGAGAGGG - Intergenic
1043198507 8:77331179-77331201 ATGGGACAAGGAAGGGGAGTTGG - Intergenic
1043426501 8:80153459-80153481 CTGGGACCTAGGAGGGGAGAGGG - Intronic
1043720830 8:83545575-83545597 CTTGGACAAGGGAGGGGAGGGGG + Intergenic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1044268065 8:90206439-90206461 TTTGGACAAGGGAGGGGAAAGGG - Intergenic
1044356158 8:91225015-91225037 CTGGGGCCAGGGAGGCTGGATGG - Intronic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1044841425 8:96340066-96340088 CTGGGACGAGCGAGGGTTTAAGG - Intergenic
1045870105 8:106916882-106916904 ATGGAAGAAGGGAGGGAAGAAGG - Intergenic
1046320189 8:112564326-112564348 AGGGGAGAAGGGAGGGGAGAAGG - Intronic
1047643088 8:126841770-126841792 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1047927382 8:129694773-129694795 CTGGGTCAAGGGATTTTAGAGGG + Intergenic
1048306718 8:133289682-133289704 CTGGGACCTGGGAGGGCAGTGGG + Intronic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1049632338 8:143665525-143665547 CAGGGACAAGGGAGTGTATGGGG + Intergenic
1049790878 8:144472282-144472304 CTGGGCCAGGGGTGGGGAGAAGG - Intronic
1050442063 9:5675072-5675094 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1050660733 9:7880181-7880203 CTGGAGCCAGGGAGGCTAGACGG + Intronic
1051029463 9:12657642-12657664 CTGGGGCAAGGGAGTGTATCTGG - Intergenic
1053028072 9:34748094-34748116 TGGGGAGAAGGGAGGGTAGGAGG + Intergenic
1053110482 9:35455550-35455572 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1053111278 9:35461743-35461765 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1055416516 9:76090214-76090236 CAGGGAGAAGGGAGGGTGCATGG - Intronic
1056414233 9:86360856-86360878 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1056642222 9:88381320-88381342 CTTGGACAAGGGAGGGGAAGGGG + Intergenic
1056656150 9:88510905-88510927 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1056950161 9:91035375-91035397 CTGGGAGATGGGAGGCTTGAGGG - Intergenic
1058485747 9:105442045-105442067 CAGAGCCATGGGAGGGTAGATGG + Intergenic
1058805001 9:108582028-108582050 CTGGGACAAGGGAGAGGACGAGG + Intergenic
1059218762 9:112591936-112591958 CTTGGACAAGGGAGGGAAAGGGG + Intronic
1059803498 9:117774032-117774054 AGGGGAGAAGGGAGGGGAGAAGG - Intergenic
1060267333 9:122120055-122120077 CAGGGACAAGGGAGAGGAGAGGG - Intergenic
1060897135 9:127225197-127225219 CTGGGCCCAGCGAGGGGAGAGGG + Intronic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1061920264 9:133778732-133778754 CTGGGGCCCGGGAGGGTCGAGGG - Intronic
1061935139 9:133853318-133853340 CTCGGCCAAGAGAGGGTGGAAGG + Intronic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062267477 9:135693910-135693932 CGGGGACAGGGCAGGGCAGACGG - Intronic
1062390080 9:136330375-136330397 CGGGGACAGGGGAGGGAGGAAGG - Intronic
1062436888 9:136550384-136550406 CTGGGTCCAGGGAGGGTACCAGG - Intergenic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1185537339 X:872857-872879 AGGGGAAAAGGGAGGGGAGAGGG - Intergenic
1186629511 X:11334140-11334162 GGAGGATAAGGGAGGGTAGATGG - Intronic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1187155110 X:16714460-16714482 CTGTGACAAGGAAAGGGAGAAGG + Intergenic
1187518350 X:19991750-19991772 CAGTGACAAGGGAGGGCAAAAGG - Intergenic
1189034824 X:37484684-37484706 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1189602534 X:42642484-42642506 CTGGGACAAGGGACAGAAGATGG + Intergenic
1189720745 X:43914082-43914104 CTGAGACAAGGCAGTGGAGAGGG + Intergenic
1189833072 X:44994713-44994735 CTTGGGCAAGGGAGGGGAAAGGG + Intronic
1189833599 X:44999299-44999321 CTTGGACAAGGGAGGGGAAGGGG + Intronic
1189834570 X:45006458-45006480 CTTGGACAAGGGAGGGGAGGGGG + Intronic
1189955571 X:46273968-46273990 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1190203200 X:48381503-48381525 ATGGGAGAAGGGAAGGGAGAAGG - Intergenic
1190207336 X:48413901-48413923 ATGGGAGAAGGGAAGGGAGAAGG + Intergenic
1190771840 X:53521278-53521300 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1192026337 X:67456752-67456774 CTGGAGCCAGGGAGGATAGATGG + Intergenic
1193152605 X:78140317-78140339 CAGGGCCAAGAGAGGCTAGAGGG - Intergenic
1193342589 X:80367833-80367855 CAGAGACAAGGAAGGGTAGTGGG + Intronic
1193539736 X:82756657-82756679 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1195494592 X:105515768-105515790 CTGTGACTAGGGAGTGTTGAGGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196237554 X:113299998-113300020 AGGGGAGAAGGGAGGGGAGACGG - Intergenic
1196237559 X:113300010-113300032 AAGGGAGAAGGGAGGGGAGAAGG - Intergenic
1197243906 X:124148570-124148592 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1197268807 X:124404010-124404032 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1198394010 X:136205290-136205312 AGGGGACCAGGGAGGGAAGAGGG + Intronic
1198742687 X:139857677-139857699 CTTGGACAAGGGAGGGGAAGGGG - Intronic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199637204 X:149825381-149825403 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1199638548 X:149836960-149836982 CTTGGACAAGGGAGGGGAAGGGG - Intergenic
1199720004 X:150536706-150536728 CTGGGACAAGGGAAAGATGAGGG - Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic