ID: 1096579168

View in Genome Browser
Species Human (GRCh38)
Location 12:52573435-52573457
Sequence CCCACCTGGGGGCATCCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096579168_1096579174 -3 Left 1096579168 12:52573435-52573457 CCTGGTGGATGCCCCCAGGTGGG 0: 1
1: 1
2: 2
3: 24
4: 191
Right 1096579174 12:52573455-52573477 GGGCACACAGACAAACATGCAGG 0: 1
1: 0
2: 1
3: 41
4: 291
1096579168_1096579176 5 Left 1096579168 12:52573435-52573457 CCTGGTGGATGCCCCCAGGTGGG 0: 1
1: 1
2: 2
3: 24
4: 191
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184
1096579168_1096579175 4 Left 1096579168 12:52573435-52573457 CCTGGTGGATGCCCCCAGGTGGG 0: 1
1: 1
2: 2
3: 24
4: 191
Right 1096579175 12:52573462-52573484 CAGACAAACATGCAGGCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096579168 Original CRISPR CCCACCTGGGGGCATCCACC AGG (reversed) Exonic