ID: 1096579174 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:52573455-52573477 |
| Sequence | GGGCACACAGACAAACATGC AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 334 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 41, 4: 291} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1096579168_1096579174 | -3 | Left | 1096579168 | 12:52573435-52573457 | CCTGGTGGATGCCCCCAGGTGGG | 0: 1 1: 1 2: 2 3: 24 4: 191 |
||
| Right | 1096579174 | 12:52573455-52573477 | GGGCACACAGACAAACATGCAGG | 0: 1 1: 0 2: 1 3: 41 4: 291 |
||||
| 1096579163_1096579174 | 21 | Left | 1096579163 | 12:52573411-52573433 | CCAAGAGGCTCTTGTTGACAGTG | 0: 1 1: 0 2: 3 3: 18 4: 130 |
||
| Right | 1096579174 | 12:52573455-52573477 | GGGCACACAGACAAACATGCAGG | 0: 1 1: 0 2: 1 3: 41 4: 291 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1096579174 | Original CRISPR | GGGCACACAGACAAACATGC AGG | Exonic | ||