ID: 1096579176

View in Genome Browser
Species Human (GRCh38)
Location 12:52573463-52573485
Sequence AGACAAACATGCAGGCCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096579168_1096579176 5 Left 1096579168 12:52573435-52573457 CCTGGTGGATGCCCCCAGGTGGG 0: 1
1: 1
2: 2
3: 24
4: 191
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184
1096579163_1096579176 29 Left 1096579163 12:52573411-52573433 CCAAGAGGCTCTTGTTGACAGTG 0: 1
1: 0
2: 3
3: 18
4: 130
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184
1096579170_1096579176 -6 Left 1096579170 12:52573446-52573468 CCCCCAGGTGGGCACACAGACAA 0: 1
1: 0
2: 1
3: 20
4: 276
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184
1096579172_1096579176 -8 Left 1096579172 12:52573448-52573470 CCCAGGTGGGCACACAGACAAAC 0: 1
1: 0
2: 7
3: 34
4: 258
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184
1096579171_1096579176 -7 Left 1096579171 12:52573447-52573469 CCCCAGGTGGGCACACAGACAAA 0: 1
1: 0
2: 4
3: 26
4: 258
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184
1096579173_1096579176 -9 Left 1096579173 12:52573449-52573471 CCAGGTGGGCACACAGACAAACA 0: 1
1: 0
2: 6
3: 36
4: 336
Right 1096579176 12:52573463-52573485 AGACAAACATGCAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096579176 Original CRISPR AGACAAACATGCAGGCCCCA GGG Exonic