ID: 1096579939

View in Genome Browser
Species Human (GRCh38)
Location 12:52578467-52578489
Sequence TTGGACTAGCATGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096579939 Original CRISPR TTGGACTAGCATGGAAAAAC AGG (reversed) Intergenic
904748449 1:32725671-32725693 TTGGGCTGGCCTGGAAATACTGG - Intergenic
909435170 1:75632603-75632625 TTTCAGGAGCATGGAAAAACAGG - Intergenic
910125891 1:83841777-83841799 TTGGAAAAGCTTGGAATAACTGG - Intergenic
910654621 1:89607186-89607208 TTGGAATAACATGGAAAGCCTGG - Intergenic
912180816 1:107217024-107217046 TTGGACTTTCAAAGAAAAACTGG - Intronic
912968466 1:114258129-114258151 TTGGACTAAAATGGAAGCACTGG - Intergenic
914401931 1:147329259-147329281 TTGGACTGTCTTGGCAAAACGGG - Intergenic
915825516 1:159071884-159071906 TGGGACTAGCTTGGAAACTCAGG - Intronic
921569981 1:216766124-216766146 GTGCACTCACATGGAAAAACTGG + Intronic
921933189 1:220772092-220772114 ATGGACTAACATGGAACCACTGG - Intronic
924106151 1:240651240-240651262 TGGGACTATCCTGGAGAAACTGG + Intergenic
1066739853 10:38510021-38510043 ATGGACTTGAATGGAAAAAGTGG + Intergenic
1066740344 10:38514007-38514029 ATGGACTCTAATGGAAAAACTGG + Intergenic
1068756886 10:60665692-60665714 TGGGATTAGGATGGAGAAACTGG - Intronic
1071372592 10:84967471-84967493 TTTAACTAGCATAGAAAAATGGG - Intergenic
1074287324 10:112110406-112110428 CGGGAATAGCATGGAAAGACTGG - Intergenic
1074324322 10:112433425-112433447 TTGTTTTAGCATGGAAAAAAAGG + Intronic
1075268602 10:121028076-121028098 TTTGACTAGAGTTGAAAAACAGG - Intergenic
1078492151 11:11779357-11779379 TGGGACTATCCTGGAAAATCTGG + Intergenic
1079511567 11:21216650-21216672 TTGGACTTGCATGGAAACTGTGG + Intronic
1080739181 11:35048034-35048056 TGAGAATAGCATGGAAAGACTGG - Intergenic
1082707969 11:56517087-56517109 ATGGACTAGCTTGTGAAAACAGG - Intergenic
1087546674 11:99592864-99592886 TTGGACAAGCATGGTAACAGAGG + Intronic
1087664531 11:101028476-101028498 TTGGAATAGACTGGAAAATCTGG - Intergenic
1091809265 12:3381198-3381220 CTGGCCTGGCATGGAAAACCAGG + Intergenic
1093834503 12:23810749-23810771 TTGGACAAGGAAGGAAAAAAGGG - Intronic
1094526626 12:31235381-31235403 TTGGGCTGGAATTGAAAAACTGG - Intergenic
1095188661 12:39230947-39230969 TTGAACTAAAATGGAAACACTGG - Intergenic
1096579939 12:52578467-52578489 TTGGACTAGCATGGAAAAACAGG - Intergenic
1097590555 12:61569369-61569391 TTAGACTATCATGGAAGAAGAGG - Intergenic
1098155166 12:67589941-67589963 TTTGAGAAACATGGAAAAACTGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1099861667 12:88230711-88230733 TAGGTCTAGGATGGAAAAATGGG - Intergenic
1101801214 12:108023455-108023477 TTGGACTAGCATGGTATAAGTGG + Intergenic
1102728565 12:115088105-115088127 TTGGACCAGAATGGAAAACATGG - Intergenic
1104274578 12:127313603-127313625 TAGGAAATGCATGGAAAAACTGG - Intergenic
1107574279 13:41700213-41700235 TGGGACTACCCTGGAAAATCTGG + Intronic
1107917238 13:45165218-45165240 GTGGAATAGAATGGAAAAAACGG + Intronic
1108057539 13:46499401-46499423 TTGGAATAAAATGGAAAAAATGG + Intergenic
1111662071 13:91224074-91224096 TTGTAGTGACATGGAAAAACAGG - Intergenic
1114709860 14:24767272-24767294 TTGGACTCCCCTGAAAAAACAGG + Intergenic
1119863986 14:77957714-77957736 ATGGGCTGGCCTGGAAAAACTGG - Intergenic
1124797905 15:32800438-32800460 TTGGACTGCCATGGAAATAAGGG - Intronic
1126166245 15:45656490-45656512 TGAGACTAGCATGGAAAACATGG - Intronic
1126771244 15:52058211-52058233 TTGGACTAGACTTGTAAAACAGG - Intronic
1126952914 15:53902186-53902208 TTGGACTAGAAGGGAAAACTAGG - Intergenic
1127233060 15:57017540-57017562 TTGGGCTAGCATGCTAAAGCAGG - Intronic
1133477959 16:6141565-6141587 TTGGACAAGCAGGGAAAGACAGG - Intronic
1133753082 16:8739720-8739742 TTTTACAAGCATGGAAATACAGG + Intronic
1142500541 17:330399-330421 ATGGACAAGCAAGGAAAGACAGG + Intronic
1143117785 17:4590467-4590489 AAGGACGAACATGGAAAAACAGG - Intronic
1143225278 17:5296578-5296600 TTATACTAGCTTGGTAAAACGGG + Intronic
1150753176 17:67885186-67885208 CTGAACTACCATGGAAAGACAGG + Intronic
1203201036 17_KI270729v1_random:275436-275458 TTGGAATGGAATGGAAAAAATGG + Intergenic
1203210630 17_KI270730v1_random:76137-76159 TTGGAATGGAATGGAAAAAATGG + Intergenic
1153744328 18:8161981-8162003 TTGGATTAGCAAGAAATAACAGG - Intronic
1158312031 18:56169434-56169456 TTGGACTCACATGGAAACATTGG + Intergenic
1159484796 18:69042130-69042152 GAGGAGCAGCATGGAAAAACTGG + Intronic
1166480805 19:43171765-43171787 TTGGACCAGCATGGGTAACCTGG + Intronic
1167058047 19:47125289-47125311 TTGGATTAGCAAGGAAGAAAGGG - Intronic
926828949 2:16938929-16938951 TTGAACTAGAATGGAAGAAGGGG + Intergenic
926956040 2:18301435-18301457 TTGGACTTGAAAGGAAAAACTGG + Intronic
927922368 2:26982992-26983014 TTGGAGTAGCATTGAAAATTAGG + Intronic
932395332 2:71442221-71442243 ATGGAATAGCATAGAAAACCTGG + Intergenic
934886089 2:98026539-98026561 TTGGCAGAGCATGGAAAAGCAGG - Intergenic
935379346 2:102435195-102435217 TAGGACTAGAATGGAAATAAAGG + Intronic
939123508 2:138147374-138147396 TTGGACTAGCCTGGCAAACATGG - Intergenic
941031940 2:160522126-160522148 TAGGACAGGCATGGAAAATCAGG - Intergenic
941735838 2:168976272-168976294 TAGCACTTGCATGGAAAGACAGG + Intronic
944719501 2:202408792-202408814 TTGAACTATCTTGGAAACACAGG + Intronic
1171929003 20:31212981-31213003 ATGGACTCGAATGGAAAAAATGG + Intergenic
1177008798 21:15706671-15706693 TTGGACCAGCATGTAAAATTGGG + Intergenic
1177057131 21:16319814-16319836 TTAGACTAGCATGGTAACAAAGG + Intergenic
1177793939 21:25752917-25752939 TGGGAGTAGCAAGGAAAAAGTGG + Intronic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1181834862 22:25596098-25596120 TAGGAATTGTATGGAAAAACTGG + Intronic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
1183121872 22:35736365-35736387 TTTGACAAGCATGCAAAACCTGG - Intergenic
1184025599 22:41853661-41853683 TTAGACTAGCCTGGAAAATCTGG - Intronic
951954161 3:28236026-28236048 TTGGGCTATCCTGGAAAAATGGG - Intergenic
955617998 3:60829305-60829327 TTTCACCTGCATGGAAAAACTGG + Intronic
956130944 3:66053402-66053424 TTAGACTAGAATGTACAAACAGG - Intergenic
958428778 3:94012747-94012769 TTGGACTAGGATGGAAGAGGAGG - Intronic
961852555 3:129836331-129836353 TTTGAATAGCATGAACAAACTGG + Intronic
966952241 3:184831809-184831831 TTGCACTATCAAGGAAAAACGGG - Intronic
972560935 4:40228472-40228494 TTGGACCAGCAAGTAAAAGCAGG + Intronic
975806683 4:78119962-78119984 GTAGACAAGCAGGGAAAAACAGG - Intronic
975928020 4:79483377-79483399 TTGTACAAGTATAGAAAAACAGG - Intergenic
976188065 4:82462749-82462771 TTGGAGTAGTTTGGAAAAAATGG + Intergenic
977025484 4:91813493-91813515 TTTGACTGGGATGCAAAAACTGG + Intergenic
977389599 4:96390977-96390999 CTGGATTAGCATGGACAAAGTGG + Intergenic
979046993 4:115879689-115879711 TTGGACTAGCATGGAGTGGCGGG - Intergenic
983582570 4:169324064-169324086 TTGGACAAGAATGGAGAAAAAGG - Intergenic
983915471 4:173287162-173287184 TTGGACTATCATGGAAAGCTTGG + Intronic
984456324 4:179974071-179974093 TTTGACTAAGATGGAATAACTGG - Intergenic
985661292 5:1158140-1158162 CTGGACTGACATGTAAAAACAGG + Intergenic
985864762 5:2505916-2505938 CTGGACTATCATGAATAAACTGG - Intergenic
987145947 5:14991869-14991891 TTGGACTTGAATGGAAGCACTGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993281774 5:85934217-85934239 GTGGACTAAGATGAAAAAACAGG + Intergenic
994323459 5:98421019-98421041 TTGGACTACAATGGAAAACTAGG + Intergenic
995940282 5:117573671-117573693 CTGGGCTAGCACGGCAAAACTGG - Intergenic
1002755477 6:155797-155819 TTGGAAAAGCATGGAGAAATGGG - Intergenic
1006357607 6:33569457-33569479 ATGGACTAACAGGCAAAAACTGG - Intergenic
1008046429 6:46855937-46855959 CTGGACAAGCAGGGAGAAACTGG + Intronic
1014393807 6:120898557-120898579 TTGGATAAACATGGAAAAGCTGG - Intergenic
1017446706 6:154512601-154512623 TTGGAATAACATGAATAAACTGG + Intergenic
1017673534 6:156791245-156791267 GTGTACTAGCATGGCTAAACTGG + Intronic
1018565767 6:165150859-165150881 TTGAACTAGCAGGAGAAAACTGG - Intergenic
1020889350 7:13859399-13859421 TTGTACTACCATGGCAAAAATGG - Intergenic
1022018342 7:26375006-26375028 GTGGACTAGGTTTGAAAAACTGG - Intergenic
1028528242 7:91809206-91809228 TAGGACATGCAAGGAAAAACTGG - Intronic
1029036291 7:97525998-97526020 TTGGACTATCACTGAAAAAGGGG - Intergenic
1035904205 8:3491760-3491782 TTTTACTAGCATGGAAATATGGG + Intronic
1037646851 8:20800083-20800105 TTGGACTAGGAGGATAAAACGGG - Intergenic
1038698695 8:29829328-29829350 TTGTACTAGCAGGGAGAAAAGGG + Intergenic
1039790466 8:40871958-40871980 TTAGACTTTCAGGGAAAAACAGG + Intronic
1043043684 8:75294224-75294246 TTGGATCAAGATGGAAAAACAGG + Intergenic
1043443026 8:80293430-80293452 TTTGACTAGCCTAAAAAAACAGG - Intergenic
1043831404 8:84993557-84993579 TTGGACTAGCACTGAAACATTGG - Intergenic
1043992619 8:86774570-86774592 TTGGACTAGAATGACATAACTGG + Intergenic
1045984164 8:108228800-108228822 TTTGACTGGCATAGAAAAAAAGG + Intronic
1046519826 8:115309781-115309803 TGAGAATAGCATGGGAAAACTGG + Intergenic
1047274294 8:123393959-123393981 TTGAACCAGCATGGCAACACTGG + Intronic
1047452587 8:124979082-124979104 TTGCACTAGCAGGAAAAAAATGG - Exonic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1048731902 8:137451624-137451646 TTGGACTAGAATGGGGAACCAGG - Intergenic
1050854276 9:10331641-10331663 TTGGACTAACAAGCAAAAATGGG - Intronic
1051082743 9:13311854-13311876 GAGGAGTATCATGGAAAAACTGG - Intergenic
1051319735 9:15889318-15889340 TTGTACTAGCATTATAAAACAGG + Intronic
1052588720 9:30463076-30463098 TGGGACTAGGAGGGAAAAATGGG + Intergenic
1053667962 9:40329822-40329844 ATGGACTAGTATTGAAAGACAGG - Intergenic
1054379108 9:64469860-64469882 ATGGACTAGTATTGAAAGACAGG - Intergenic
1054516649 9:66046463-66046485 ATGGACTAGTATTGAAAGACAGG + Intergenic
1054922758 9:70558433-70558455 TTGGAATGGCATGGAAAGATTGG + Intronic
1057990401 9:99762834-99762856 ATGGTCTAGCATGAAAAGACGGG - Intergenic
1059480990 9:114589416-114589438 TTCGCCTTGCATGGAAAAAGAGG - Intronic
1061207705 9:129174251-129174273 TTGGACTTGCAGGGGAAAATGGG + Intergenic
1186320861 X:8423592-8423614 TTGCACAAGCTTGGAAAAATGGG + Intergenic
1188970224 X:36606189-36606211 TTGAACAATCATGGACAAACAGG + Intergenic
1189573073 X:42320414-42320436 TTGGACTGTCTTGCAAAAACTGG + Intergenic
1193521849 X:82539926-82539948 TTGAACTAGCCTTGAATAACTGG + Intergenic
1194505281 X:94726810-94726832 TAGGGCAAGCCTGGAAAAACAGG - Intergenic
1197017122 X:121638436-121638458 TGGGAAGAGCATGGGAAAACTGG - Intergenic
1197037053 X:121886225-121886247 TTTAACGAGTATGGAAAAACTGG - Intergenic
1198812931 X:140554146-140554168 TTGGTCTGGCATGCACAAACAGG + Intergenic
1199355850 X:146862923-146862945 TAGGACTATCATGGAAGAAGTGG - Intergenic
1201385669 Y:13437171-13437193 TAAGACTAGGAGGGAAAAACAGG + Intronic