ID: 1096580342

View in Genome Browser
Species Human (GRCh38)
Location 12:52580919-52580941
Sequence CCATAGGCAATGTGGAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096580331_1096580342 11 Left 1096580331 12:52580885-52580907 CCAGGCAGGGCAGAAGCACTAGG 0: 1
1: 0
2: 0
3: 27
4: 250
Right 1096580342 12:52580919-52580941 CCATAGGCAATGTGGAAATTGGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096580342 Original CRISPR CCATAGGCAATGTGGAAATT GGG Intergenic
900896869 1:5488990-5489012 CCATAGGAATTGTGCAATTTTGG - Intergenic
905832842 1:41087368-41087390 CCATAAGCAAAGTACAAATTGGG + Intronic
908107146 1:60856633-60856655 CTACAGGAAATGTGGAAACTGGG - Intergenic
909042170 1:70667805-70667827 CCACAGACAGTGTGAAAATTAGG + Intergenic
909409893 1:75337953-75337975 CTAAAGGCAATGTGGAGAATTGG + Intronic
909917735 1:81340955-81340977 CCATTGACGATGTGGAAAATGGG - Intronic
910742041 1:90530067-90530089 CAAAAGCCAATGTGGAAATCTGG - Intergenic
912246028 1:107963246-107963268 CTACAGGCAAAGTGGAAAATGGG + Intronic
915090094 1:153418203-153418225 ACACAGGCACTGAGGAAATTGGG - Exonic
915849920 1:159310408-159310430 CCAGAGGGAATGTGGAACATAGG + Intergenic
916234665 1:162574691-162574713 GAAGAGGCTATGTGGAAATTGGG - Intronic
917506256 1:175629691-175629713 CCATGGTCAAAGTGGAGATTTGG + Intronic
917726669 1:177834284-177834306 CTAGGGGCAATGTGAAAATTTGG + Intergenic
921837583 1:219794107-219794129 CCATAGGCAATGTGGGATTAGGG - Intronic
922194396 1:223347140-223347162 CAATAAGCAATATGGAAAATTGG + Intronic
922700850 1:227759768-227759790 CCAAAGCTCATGTGGAAATTTGG + Intronic
924036698 1:239945203-239945225 CCAAATGCCATGAGGAAATTAGG + Intergenic
1062839123 10:657014-657036 ACATGGGCCATGTGGAAAGTTGG + Intronic
1063238765 10:4146502-4146524 GCATTGGCTATGTGGAAATGCGG - Intergenic
1065498951 10:26359694-26359716 CCATAACCAATGTTGAAAATTGG + Intergenic
1066362102 10:34741120-34741142 CCATAGGCAATTTGTAGGTTTGG - Intronic
1067423101 10:46175476-46175498 GCAAAGGCAATGTGGAGAATAGG - Intergenic
1067723614 10:48749697-48749719 CTATAGGCAATGTGGAGCTAGGG + Intronic
1069029239 10:63578020-63578042 ACAAAGTCAATTTGGAAATTTGG - Intronic
1072035357 10:91558262-91558284 CCATAGGCAATGGGAAGACTTGG - Intergenic
1074007430 10:109441956-109441978 CCAGTGGGAATCTGGAAATTAGG - Intergenic
1074468093 10:113701997-113702019 CCTGAGGCAATATTGAAATTGGG + Intronic
1079690606 11:23412470-23412492 TCATGGCCAATGTGAAAATTGGG + Intergenic
1080454114 11:32402849-32402871 CCCTAGAAAATGTGGAAAGTAGG - Intronic
1081563027 11:44236494-44236516 CCATGTGCACTGTGGGAATTGGG + Intronic
1081819472 11:45977694-45977716 CCCAAGGCTATTTGGAAATTAGG - Intronic
1081944806 11:46981817-46981839 CCAAAGGGAATGGGGAAATGAGG - Intronic
1089236773 11:117035252-117035274 AGATAGGCAATGAGGAAATGAGG + Intronic
1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG + Intergenic
1090482260 11:127079073-127079095 CCAAAGCCCATGTGGAAATACGG + Intergenic
1091397358 12:162236-162258 CAAGAGGCAATGAGGAAATCAGG - Intronic
1091984070 12:4893596-4893618 TTATAGGCAATGTGGACATGTGG - Intergenic
1092141535 12:6187094-6187116 CAAAATGCAATGTGGAAACTTGG + Intergenic
1096580342 12:52580919-52580941 CCATAGGCAATGTGGAAATTGGG + Intergenic
1096772948 12:53947972-53947994 CTGTAGGCAAACTGGAAATTGGG + Intergenic
1097422786 12:59401438-59401460 CCATTGGCAATATGGAATTTAGG - Intergenic
1098482000 12:70973531-70973553 CCAGAGTAAATGTGGAAATTTGG + Intergenic
1098762813 12:74446605-74446627 CCAAAGGCAATGTGGAGCTCAGG - Intergenic
1100282050 12:93127477-93127499 GCATGAGCAATGTGGAAATTCGG + Intergenic
1100449396 12:94690825-94690847 TCATAAGCAATGGGGAAACTAGG + Intergenic
1101578607 12:106021095-106021117 CAATAGTCAGTATGGAAATTGGG + Intergenic
1107235396 13:38162468-38162490 CTATTGGAAATGTGGAAATGAGG + Intergenic
1107537925 13:41354119-41354141 CAATGGACAATGTGGAAATAAGG - Intronic
1108926908 13:55761441-55761463 CCATAAACAATGTAGAAAGTTGG - Intergenic
1110021721 13:70481735-70481757 AGATAGGCATTGTGGAATTTAGG - Intergenic
1110215072 13:73016444-73016466 CCATTGGTAAAGTGAAAATTTGG + Exonic
1110492760 13:76128093-76128115 CAATATGTAATGTGGAGATTTGG + Intergenic
1115721737 14:36169143-36169165 CCATATTGAATGTGTAAATTTGG - Intergenic
1118134402 14:63005950-63005972 ACATAGGCAATGTGAATATGTGG - Intronic
1124399721 15:29337599-29337621 CCACAGGGAATGTGGAAATGTGG - Intronic
1124627762 15:31318772-31318794 CCGTAATCAATGTGGAAAATGGG - Intergenic
1127690764 15:61394718-61394740 CCAAAACCAATGTGTAAATTTGG - Intergenic
1129772972 15:78214342-78214364 CCAGAGGCAATTTGGAATTTGGG - Intronic
1130327645 15:82894155-82894177 ACATAGGTAATATGCAAATTTGG - Intronic
1134486636 16:14663765-14663787 CCATAGCCAATGTTGAATTTAGG + Intronic
1138953719 16:61945516-61945538 TCATAGGCAATGTGGATCTCTGG + Intronic
1149308291 17:55370425-55370447 CAAAATGCAATGTGGAAAATAGG - Intergenic
1151172045 17:72254950-72254972 TCATACGCAATGGAGAAATTGGG - Intergenic
1151373715 17:73668018-73668040 CCCAAGGCTATGGGGAAATTGGG + Intergenic
1151602909 17:75117439-75117461 CCATAAGCCATCTGGGAATTTGG - Intronic
1152840961 17:82567833-82567855 CAAGAAGCAATGTGGAAATAGGG - Intronic
1153155958 18:2149154-2149176 CCATAGGCAATGTACAATTTTGG - Intergenic
1153690214 18:7584993-7585015 ACATAGACAGCGTGGAAATTAGG + Intronic
1153778209 18:8472245-8472267 CCATAGAAAATTGGGAAATTGGG + Intergenic
1153801636 18:8676121-8676143 CCCCTGGAAATGTGGAAATTGGG + Intergenic
1155263136 18:24064647-24064669 CATTGGGCAATGTGGAAAATGGG + Intronic
1156349390 18:36290372-36290394 CAATATGCAATGGTGAAATTGGG + Intergenic
1159800311 18:72890605-72890627 CGATAAGCATTGTAGAAATTTGG + Intergenic
1161480466 19:4507869-4507891 CCTTTGGCAATGTGGACGTTGGG - Intronic
1162147100 19:8619563-8619585 CCGTAGGCACTGTGGAACTTCGG - Intergenic
1164801394 19:31079776-31079798 CCATGGGAAATATGGATATTAGG - Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1166584230 19:43931198-43931220 CCATAGAAAAAGTGGAAAGTGGG + Intronic
927719290 2:25372702-25372724 GCCTAGGCAATGAGGAAAGTAGG + Intergenic
929868755 2:45740294-45740316 CCCTAGGGAATGTGGGAATCTGG + Intronic
933262141 2:80142612-80142634 TCATATGCATTGTGGAACTTTGG - Intronic
933477041 2:82803962-82803984 AGAAAGGCAATGTGGTAATTTGG - Intergenic
933735523 2:85490885-85490907 TCTTAAGCAATGTGGAAATAAGG - Intergenic
934096621 2:88612582-88612604 ACACAGCAAATGTGGAAATTTGG + Intronic
935469235 2:103436925-103436947 CCATAGACAGTGTAGAAATGTGG + Intergenic
937543254 2:122985604-122985626 AGATAGGTAATGTGGAAATAGGG - Intergenic
939478932 2:142723677-142723699 CCATATGCAATGTCAAAATAAGG + Intergenic
939677021 2:145085147-145085169 CTATAGGCAAAGGGGAAAATGGG + Intergenic
939978833 2:148754128-148754150 CGAAAGGTAATGTGCAAATTAGG + Exonic
940696342 2:156984475-156984497 CGATAGGCCATCTGCAAATTTGG + Intergenic
941588623 2:167390380-167390402 CCATTGGCAATGGGGAGGTTAGG - Intergenic
947970751 2:234321626-234321648 CCATAGGCAATGTCAAATATAGG + Intergenic
1168934716 20:1654279-1654301 CTGTAGTCAATGTTGAAATTAGG - Intronic
1169728570 20:8762522-8762544 CTATAGGCAGTTTGGAAATAAGG - Intronic
1170771725 20:19338648-19338670 TCAAATGCAATGTGGAAATCTGG + Intronic
1173686340 20:44926127-44926149 ACAAAGGAAATGTGTAAATTTGG + Intronic
1173946954 20:46959300-46959322 CCCTTGGCACTGTGGAGATTTGG + Intronic
1174298588 20:49566779-49566801 CTAAAGGCAATGTGGTAACTTGG + Intronic
1181792733 22:25280806-25280828 TCATAGGAAAAGTGGAAATGAGG - Intergenic
1181813271 22:25418400-25418422 TCATAGGAAAAGTGGAAATGAGG - Intergenic
1181831298 22:25562863-25562885 TCATAGGAAAAGTGGAAATGAGG - Intergenic
1182672514 22:32008701-32008723 CTATAGGTAATGTTGAATTTGGG - Intergenic
950149424 3:10675102-10675124 ACATAGGCGATGTGGGAAGTGGG + Intronic
954666180 3:52253817-52253839 CCATGAGCAATGTGAAAATGTGG + Intergenic
956062216 3:65359001-65359023 GCAGAAGCAATGAGGAAATTAGG + Intronic
957466520 3:80599929-80599951 CCAAAAGAAATGTGTAAATTTGG - Intergenic
957571725 3:81955458-81955480 TGATAGGCAATTTGGAAATCTGG + Intergenic
957932557 3:86899902-86899924 CCATAGGCAATCTGGAATGATGG - Intergenic
960372682 3:116860319-116860341 CCATATGGAAAGAGGAAATTTGG - Intronic
961871791 3:129993710-129993732 CCTGAGGCAATGTGGAAAGAGGG - Intergenic
963962954 3:151330518-151330540 GCATAGGAAAAGCGGAAATTAGG + Intronic
967201882 3:187079171-187079193 CCTTTTGAAATGTGGAAATTTGG + Intergenic
968723946 4:2230784-2230806 CCACAGGCCATGTATAAATTGGG + Exonic
970221387 4:13815435-13815457 CCATTGTCTGTGTGGAAATTGGG + Intergenic
971697751 4:29928801-29928823 CCATAAGAAATGTGGTAATAAGG - Intergenic
973116215 4:46463490-46463512 CCATAAGTAATGTGTAAATGAGG + Intronic
973856474 4:55015672-55015694 CCATAGGGAACCTGGTAATTTGG - Intergenic
976620550 4:87122744-87122766 CTATAGACAATCTGAAAATTGGG - Intronic
976621844 4:87136341-87136363 CTCTAGGCAATGGGGAGATTGGG - Exonic
979501664 4:121447125-121447147 ACCTAGGAAATGTGGAAATCAGG - Intergenic
981210433 4:142097555-142097577 CCATAGACAATATGCAAATCAGG - Intronic
982609427 4:157554775-157554797 ACACAGGCAATTTGGGAATTAGG + Intergenic
983994654 4:174167033-174167055 CCCTAGGCCTTGTGGAAAATTGG - Intergenic
985665489 5:1179793-1179815 ATATAGGAAATGTGGAAAATGGG - Intergenic
986374921 5:7121189-7121211 GCATAGGCTATATGGAAATACGG + Intergenic
986854362 5:11851708-11851730 CCATTGCCAATGTGGAGACTTGG - Intronic
989146479 5:38256031-38256053 CCATAGGCGATTTGGGAAATAGG - Intergenic
989422278 5:41253907-41253929 CAAAAGGCAATGTGTAATTTGGG + Intronic
990937675 5:61167585-61167607 CAATAGGCAATTTTGAAGTTTGG - Intergenic
991301725 5:65134878-65134900 CCAAAGGCACTGTGTAGATTGGG - Intergenic
991962702 5:72061855-72061877 CCATAGCCAATGAGGACATGTGG - Intergenic
994538651 5:101064997-101065019 CCATAAGCAATGCAGATATTGGG - Intergenic
995155960 5:108913486-108913508 AGATAGGCAAAGTAGAAATTTGG + Intronic
996518663 5:124401639-124401661 CCTGAGGCAATGAGGAAATCAGG - Intergenic
997347984 5:133207329-133207351 CGTCAGGCAATGTGGAATTTAGG - Intronic
999664519 5:153898685-153898707 CCTTATGCATTGTGTAAATTTGG + Intergenic
1000718619 5:164678745-164678767 TCATAGGCCGTGTGGAAAATGGG + Intergenic
1001843802 5:174903393-174903415 CCATGTGCAATCTGGAAAGTTGG - Intergenic
1001856487 5:175015209-175015231 CATTATGCAATGTGGACATTGGG + Intergenic
1003424563 6:5989438-5989460 CCATAGTGAATGTGGACATGTGG + Intergenic
1005297989 6:24445623-24445645 TCACAGGCAATGGGGAAACTGGG - Exonic
1007024398 6:38555416-38555438 CCATAGTGAATGTGGAAAAGGGG + Intronic
1008278975 6:49573114-49573136 CCAGAAGCAATGAGGAAACTAGG + Intergenic
1011979250 6:93351676-93351698 CCATAGGCAACGGAGAGATTTGG - Intronic
1012470020 6:99561285-99561307 ACATAGGCCATGTGAAAACTGGG + Intronic
1012981158 6:105831368-105831390 CCATAGGAAATGGTGAAATAGGG + Intergenic
1013996875 6:116319424-116319446 CTATAGGGAATGAGGAAATATGG + Intronic
1015126505 6:129761002-129761024 TCATAGGCAAATTGGAAAATAGG + Intergenic
1015137044 6:129884326-129884348 CCAAAGACAGTGTTGAAATTTGG + Intergenic
1015400665 6:132784641-132784663 CGGTAGGCAATTTGGCAATTTGG + Intronic
1016381379 6:143485417-143485439 CCATAGCAAATGTGTAAGTTTGG + Intronic
1017958114 6:159196369-159196391 CCAGAGGCAATGGGCAATTTTGG + Intronic
1018437665 6:163777413-163777435 CCATAGATAATGTGCAAAGTGGG - Intergenic
1019227953 6:170530653-170530675 CCATGGGCAATTTGGAATGTTGG - Intergenic
1020268057 7:6574610-6574632 GCAAAGGCAAAGTGGAAATTTGG + Intergenic
1020990298 7:15187310-15187332 CCATATGCAATGTGCAAACAGGG - Intergenic
1021491529 7:21224497-21224519 CAAAAGGAAATGTGGAAATTGGG + Intergenic
1021581253 7:22156420-22156442 CCAAAGTCAATGTGCAGATTTGG - Intronic
1021696240 7:23278829-23278851 CCATAGGCATTTTGGGATTTGGG + Intergenic
1021986290 7:26101401-26101423 TCATTGGGAATTTGGAAATTTGG - Intergenic
1022780028 7:33571864-33571886 CCATTGGCAATGATCAAATTAGG + Intronic
1023467318 7:40470232-40470254 CCAAAGGCAAGCAGGAAATTGGG - Intronic
1024239533 7:47423644-47423666 CCCTGGGCAATATGGAAATCAGG - Intronic
1027846805 7:83388646-83388668 CCATATGCAATGATGAAATTTGG + Intronic
1030750898 7:113231274-113231296 CCATAGATAATGAGGAAATTAGG + Intergenic
1031251044 7:119380714-119380736 TAATAGCCAATGTGGAAATGAGG + Intergenic
1033175587 7:139120717-139120739 TCATATTCACTGTGGAAATTTGG - Intergenic
1036138386 8:6182741-6182763 CCAAGGGCACTGTGGAAATCAGG - Intergenic
1036610736 8:10347637-10347659 GCATAAGCAAAGTGGAACTTTGG - Intronic
1038831997 8:31072149-31072171 CCATAGACATCGAGGAAATTAGG + Intronic
1039896833 8:41722806-41722828 CCACAGGCAATATGCAAACTAGG - Intronic
1040925006 8:52671207-52671229 ACATAGGTATTTTGGAAATTAGG - Intronic
1041284080 8:56242574-56242596 CCAAAGGCAATGTAGTGATTGGG - Intergenic
1041921435 8:63186772-63186794 CCAAGGGCAATGTGGGAATTGGG + Exonic
1044687522 8:94841660-94841682 CCATAGGAAATTTGAAAATGTGG - Intronic
1045307480 8:100971017-100971039 CCACATGTAATGTGAAAATTAGG + Intergenic
1046477176 8:114760848-114760870 CCATATCCAATGTGGTATTTTGG - Intergenic
1046916681 8:119684958-119684980 TCAAAGTCAATGGGGAAATTTGG - Intergenic
1048974960 8:139666106-139666128 CCATGGGCCCTGTGGCAATTAGG + Intronic
1050107296 9:2178797-2178819 CTATAGGTAATGTGGAAGCTAGG + Intronic
1051104689 9:13566112-13566134 CTATGGACAATGAGGAAATTGGG + Intergenic
1051973510 9:22920644-22920666 CCATCAGCAATCTGGAAATACGG + Intergenic
1052988931 9:34507210-34507232 CCTTAGACAATGTGGGAATGAGG + Intronic
1055248813 9:74277878-74277900 ACATACGTAATTTGGAAATTGGG - Intergenic
1055882995 9:81024180-81024202 CCATAGGCCATCTGTAAACTGGG - Intergenic
1057055601 9:91958239-91958261 CTTTAGGAAATGGGGAAATTTGG + Intergenic
1059246916 9:112856573-112856595 GCAGAGGGAAAGTGGAAATTGGG + Intronic
1185811279 X:3112880-3112902 CGATAGGCAAGGTGGAGACTGGG - Intergenic
1186034414 X:5405423-5405445 CCTTGAGCAATGTGGAGATTCGG - Intergenic
1199617379 X:149668219-149668241 CCAGAGGCAAAGAGGAAATGCGG - Intergenic
1199625264 X:149735030-149735052 CCAGAGGCAAAGAGGAAATGCGG + Intergenic
1200008525 X:153104117-153104139 CCATAGGCAGTGTAGATGTTTGG + Intergenic
1200040826 X:153366509-153366531 CCACAGGCAATGTATTAATTAGG - Intergenic