ID: 1096583109

View in Genome Browser
Species Human (GRCh38)
Location 12:52601155-52601177
Sequence CCCACCCGGGGGCATCCCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096583109_1096583120 8 Left 1096583109 12:52601155-52601177 CCTGAGGGATGCCCCCGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1096583120 12:52601186-52601208 GGGACACTTGGGCCCCAGCCCGG 0: 1
1: 0
2: 2
3: 33
4: 299
1096583109_1096583118 -4 Left 1096583109 12:52601155-52601177 CCTGAGGGATGCCCCCGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1096583118 12:52601174-52601196 TGGGCACACGGAGGGACACTTGG 0: 1
1: 0
2: 1
3: 50
4: 201
1096583109_1096583125 23 Left 1096583109 12:52601155-52601177 CCTGAGGGATGCCCCCGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1096583125 12:52601201-52601223 CAGCCCGGCGCTGCCGAAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 107
1096583109_1096583122 20 Left 1096583109 12:52601155-52601177 CCTGAGGGATGCCCCCGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1096583122 12:52601198-52601220 CCCCAGCCCGGCGCTGCCGAAGG 0: 1
1: 0
2: 2
3: 19
4: 228
1096583109_1096583119 -3 Left 1096583109 12:52601155-52601177 CCTGAGGGATGCCCCCGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1096583119 12:52601175-52601197 GGGCACACGGAGGGACACTTGGG 0: 1
1: 0
2: 0
3: 35
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096583109 Original CRISPR CCCACCCGGGGGCATCCCTC AGG (reversed) Exonic