ID: 1096585001

View in Genome Browser
Species Human (GRCh38)
Location 12:52614253-52614275
Sequence GGATTCCTGCCCAAGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096584998_1096585001 -10 Left 1096584998 12:52614240-52614262 CCTCTATCCCTGGGGATTCCTGC 0: 1
1: 0
2: 2
3: 14
4: 195
Right 1096585001 12:52614253-52614275 GGATTCCTGCCCAAGACCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 159
1096584997_1096585001 -6 Left 1096584997 12:52614236-52614258 CCTACCTCTATCCCTGGGGATTC 0: 1
1: 1
2: 4
3: 137
4: 1446
Right 1096585001 12:52614253-52614275 GGATTCCTGCCCAAGACCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096585001 Original CRISPR GGATTCCTGCCCAAGACCCC AGG Intronic
900221459 1:1511611-1511633 GCCCTCCCGCCCAAGACCCCGGG - Intergenic
900918075 1:5652291-5652313 GGGTGCCTGCCCATGTCCCCAGG + Intergenic
901452214 1:9342682-9342704 GGATGTGTGCCCCAGACCCCTGG - Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
903069404 1:20719342-20719364 GGATGCCTGCCCTACACCCTGGG - Intergenic
903305373 1:22409189-22409211 GGAATCCTGCCCCATAGCCCAGG - Intergenic
903624245 1:24719966-24719988 GGATTCTAACCCAAGACCTCTGG + Intergenic
904946102 1:34199869-34199891 GCCTTCCTCCCCAATACCCCTGG + Intronic
906112817 1:43335877-43335899 GGATGCCTTCCCCAGTCCCCAGG - Intergenic
907457106 1:54582910-54582932 GAATTTCTTCCCAATACCCCTGG + Intronic
908280612 1:62530909-62530931 GGCCTCCTGCCCAAGCCCCATGG + Intronic
908354378 1:63316879-63316901 GCCTTCCTGCCCAAGACCACTGG - Intergenic
909988009 1:82186212-82186234 GTTCTCCTGCCCAGGACCCCAGG - Intergenic
912486749 1:110034983-110035005 GGACTCATGCTCCAGACCCCAGG - Intronic
915981966 1:160425900-160425922 GTATCCCTGCCCTAGAACCCAGG - Exonic
916635596 1:166664598-166664620 GGATTCCTGCCTTAGCCCCCAGG - Intergenic
916959346 1:169873128-169873150 GAATTCCTGCCCATGACACATGG - Intronic
921116870 1:212100273-212100295 GTACTCCTGCCAAAGCCCCCAGG + Exonic
1064876428 10:19999974-19999996 GAATTCCAGCCCAAGAGTCCTGG + Intronic
1067471724 10:46542732-46542754 GGATTCGTGTCCAAGAGCCAAGG - Intergenic
1067693458 10:48519286-48519308 GCATTCCTGCCCAGGTCCACTGG + Intronic
1068982149 10:63073022-63073044 GAATTTCTGCCCAAGCCCTCGGG + Intergenic
1073311532 10:102546247-102546269 TGTTTCCTGCTCAAGAACCCTGG - Intronic
1077844809 11:6013090-6013112 GGACTCCTGCCCAAGAGCACAGG + Intergenic
1079586213 11:22128961-22128983 GGTTTCCTGGGCCAGACCCCGGG - Intergenic
1080453978 11:32401933-32401955 GCCTCCCTGCCCAGGACCCCTGG - Intronic
1084944666 11:72632191-72632213 GGATACCTGCCCACGACTACTGG + Intronic
1085280226 11:75325231-75325253 GGATTCCTGCCCCACCCCTCTGG - Intronic
1085462974 11:76706410-76706432 GGATTCTTGCCCAAGATTCCTGG - Intergenic
1089560018 11:119339107-119339129 GGATTTCTGCCCAAGACCAGAGG - Exonic
1091637551 12:2208948-2208970 TGATCCCTGCCCCAGACCCCTGG + Intronic
1095299145 12:40561939-40561961 GTATTCCTGCCAAACAGCCCTGG + Intronic
1096585001 12:52614253-52614275 GGATTCCTGCCCAAGACCCCAGG + Intronic
1101418971 12:104533241-104533263 GGATTCCTGACCAAGACTTGAGG + Intronic
1102788069 12:115620309-115620331 TGTTGCCTGCCCAAGACCACAGG + Intergenic
1104563496 12:129859717-129859739 TGCTTCCTGCCCCAGACTCCAGG + Intronic
1105016249 12:132787863-132787885 GGACCCCTTCCCGAGACCCCAGG + Intronic
1110174243 13:72537005-72537027 GGATTCCTGATCAAGCCACCAGG + Intergenic
1110552754 13:76827001-76827023 GGATTCCTGACCTGGACCCACGG + Intergenic
1110872023 13:80463406-80463428 GTATTCCTCCCCTAAACCCCAGG - Intergenic
1111127563 13:83931087-83931109 GGAGTCCTGATCCAGACCCCAGG + Intergenic
1111237670 13:85430849-85430871 GGGCTCCTGCCCAAGAGCGCAGG - Intergenic
1113782949 13:112986955-112986977 GGCGTCCTGCCCAAGGCTCCGGG + Intronic
1117978637 14:61321477-61321499 GGATCCCCGCGCAAGCCCCCGGG - Intronic
1119037133 14:71240017-71240039 GGGATCCTTCCCAAAACCCCAGG - Intergenic
1119546083 14:75472407-75472429 GGCTTCCTGCACAAGTTCCCTGG - Intronic
1121235879 14:92390986-92391008 GGATGCATGTCCAAGACCCTGGG - Intronic
1122931445 14:104934489-104934511 TGGTTCCTGACCAAGACCACAGG + Exonic
1125474586 15:40038631-40038653 GGATCCCTGACAAAGAGCCCTGG + Intronic
1125908510 15:43415456-43415478 GGGGTCCTGCCCAAGCCCACAGG - Intronic
1128264518 15:66254641-66254663 GGCTTCCTCCCCATGGCCCCCGG - Intergenic
1129297233 15:74606328-74606350 GGACCCCTGCCCAGGACCCAGGG + Intronic
1129684215 15:77676100-77676122 GGACTACTGCCCCAGACCCCAGG + Intronic
1130330464 15:82918326-82918348 GGATCCCTGGCAAAGACCTCTGG - Intronic
1132710236 16:1263129-1263151 GGCTCCATGTCCAAGACCCCAGG - Intergenic
1133125412 16:3642935-3642957 GCACTCCTGCCCAGGACCCGAGG + Exonic
1134015566 16:10885695-10885717 TGATTTGTGCCCAAGAGCCCAGG - Intronic
1134360243 16:13524256-13524278 GGAGTCCAGCCCAAGAAACCAGG - Intergenic
1135471409 16:22734664-22734686 GGATTCTTCCCCCAGGCCCCTGG - Intergenic
1135522130 16:23185901-23185923 GAGTTCCTGCCCAGGAACCCGGG + Intronic
1137580477 16:49630746-49630768 GTTTTCCTGCCCAAGCCCCTGGG - Intronic
1138266539 16:55663905-55663927 GGAGTCCTGCCCCAGGCCCTGGG + Intronic
1138584765 16:57962649-57962671 GGAGACCTGCCCCAGCCCCCTGG + Intronic
1139423841 16:66866588-66866610 GCCTTGCTGCCCAAGACCCCAGG + Intronic
1140477840 16:75247874-75247896 TGTTCTCTGCCCAAGACCCCAGG + Intronic
1140925198 16:79575822-79575844 GAATCCCTGGCCAAGACCCTAGG + Intergenic
1141079028 16:81034847-81034869 GTATTCCTTCCCAAGGCTCCAGG - Intergenic
1141558779 16:84853335-84853357 GGAGTCATCCCGAAGACCCCCGG + Intronic
1142768008 17:2076495-2076517 GGCTTCCTGCCCAGAACCACGGG - Intronic
1143982095 17:10878955-10878977 AGATAGCTCCCCAAGACCCCAGG - Intergenic
1143995838 17:11005820-11005842 GGAATCCTGGCCAGCACCCCTGG - Intergenic
1146032301 17:29376718-29376740 GAATTCCTGCCCAAGATCAAGGG + Intergenic
1146694221 17:34896650-34896672 GGCTTCCTGCCCAAGACAGCTGG + Intergenic
1147914729 17:43879524-43879546 GGACTCATGTCCCAGACCCCCGG - Intronic
1148332509 17:46820804-46820826 GGAGTCCTGCCCAAGGGCTCGGG + Intronic
1148640815 17:49185801-49185823 GGGGTGCTGCCCAAGACCACAGG + Intergenic
1151462057 17:74260344-74260366 GGATTCCCGACCAAAGCCCCAGG + Exonic
1152488686 17:80613945-80613967 GGATTCCTGCCCCAGATCTTGGG + Intronic
1152528922 17:80905700-80905722 GGAGCCCTGACCTAGACCCCGGG + Intronic
1153444098 18:5152883-5152905 TGATACCTCCCCAGGACCCCAGG - Intronic
1157574314 18:48733490-48733512 GGAGCCATGCCCAAGACCCAGGG + Intronic
1158402227 18:57131421-57131443 GGATTCCTGCCCTAGGGCTCTGG - Intergenic
1158488289 18:57887925-57887947 GCATTCCTGCCCACCAGCCCAGG + Intergenic
1163615295 19:18323516-18323538 GGAATCCTGACCACGACCCTCGG + Intergenic
1164205378 19:23054166-23054188 GTATTCCTGGCCAAAAACCCAGG - Intergenic
1164294487 19:23897718-23897740 GTATTCCTGGCCAAAAACCCAGG + Intergenic
1164673704 19:30088197-30088219 GGATTCCTGCCTAAGTTCCAGGG + Intergenic
1167874029 19:52396844-52396866 GGTCACCTGCCCAGGACCCCAGG + Intergenic
925191234 2:1885473-1885495 GGATCCCTGTCCAAGGCCCTAGG - Intronic
925459999 2:4053865-4053887 GGATCCCTGCGCAAAACCTCAGG - Intergenic
926109266 2:10171664-10171686 GGATGCCACCCCAGGACCCCTGG + Intronic
928143264 2:28749472-28749494 CCATTCCTGCCCAAGACTCCAGG + Intergenic
928167318 2:28980613-28980635 GGATTTCCGCCCAAGAGCCTGGG + Intronic
931238557 2:60432665-60432687 GGATTCAGGACCAAGACTCCCGG - Intergenic
935804758 2:106734651-106734673 GCATTTCTGGCCAAGTCCCCTGG + Intergenic
936937173 2:117849553-117849575 GCAATTCTGCCCAAGACCCTGGG - Intergenic
936979424 2:118250500-118250522 GGACTCCTGGCCAAGATCACTGG - Intergenic
946042686 2:216795981-216796003 GAATCCCTACCCAAAACCCCAGG - Intergenic
946144409 2:217718108-217718130 GGATTGCTGCCCAGGGTCCCTGG - Intronic
948403940 2:237703614-237703636 GGATGCCTTCCCCAGCCCCCCGG + Intronic
1169075053 20:2755287-2755309 GGATTTCTGCTGAAAACCCCTGG - Intronic
1169501846 20:6168097-6168119 AGATTCCTGCCTAACACCACTGG - Intergenic
1169743618 20:8920729-8920751 GGATTCCAGCCCAGGGCCCTGGG + Intronic
1170154455 20:13256749-13256771 GGAATCCTGCCAAAGTCACCTGG - Intronic
1171425125 20:25044134-25044156 GAATTCCTGGCCCAGACCCCAGG + Intronic
1171797609 20:29578466-29578488 GGGGTCCTGCCCCAGATCCCAGG + Intergenic
1171850645 20:30305695-30305717 GGGGTCCTGCCCCAGATCCCAGG - Intergenic
1172145165 20:32752425-32752447 GGTGACATGCCCAAGACCCCAGG - Intergenic
1174519105 20:51116013-51116035 AGTGGCCTGCCCAAGACCCCAGG - Intergenic
1174663466 20:52235561-52235583 GGAGTCCTGCTCTAGGCCCCAGG - Intergenic
1176374417 21:6080111-6080133 GGATGCATGCCCCAGACCCAGGG + Intergenic
1179579171 21:42329277-42329299 GGTTGCCTGGCCAATACCCCAGG + Intergenic
1179749059 21:43458134-43458156 GGATGCATGCCCCAGACCCAGGG - Intergenic
1183987297 22:41576587-41576609 GGAATTCCTCCCAAGACCCCTGG + Exonic
1184064981 22:42113388-42113410 AGTTTCCCACCCAAGACCCCCGG - Intergenic
1185100354 22:48836950-48836972 GGATTTCCTCCCAAAACCCCAGG - Intronic
950473902 3:13203948-13203970 GCTTTCCTGCCCTAGGCCCCTGG + Intergenic
954794567 3:53155001-53155023 GGATGCCTGCCCAGTACCCACGG + Intergenic
955918472 3:63930022-63930044 AGATTCCTGCCAAAGACTACTGG - Intronic
961220325 3:125194270-125194292 GTCTTCCTTCCCAAGCCCCCAGG + Intronic
962984103 3:140518665-140518687 GGATTCCTGCTGCAGGCCCCTGG - Intronic
965322753 3:167268419-167268441 AGCTTCCTGGCCAAGACCCCTGG + Intronic
968166918 3:196473915-196473937 GTATTTCTCACCAAGACCCCTGG + Intronic
970574731 4:17416359-17416381 GGATTCCTGCCCTACACTCCTGG + Intergenic
970615339 4:17763521-17763543 CTATTCCTGTCCTAGACCCCTGG - Intronic
970618095 4:17786676-17786698 GGTTTCCTGTCCATGACACCTGG + Intergenic
976194865 4:82522849-82522871 GGATTCTTGCCAAAGACACCAGG + Intronic
976772690 4:88671082-88671104 GGATTCCTGCCTACCACCTCTGG + Intronic
983790848 4:171795396-171795418 CGATTCCTGCCGAAGCCACCTGG + Intergenic
984853110 4:184170708-184170730 GGATTCTTGCCTAAGACACATGG - Intronic
985035727 4:185838341-185838363 GGTGGCCTGCCCAAGCCCCCAGG - Intronic
989720816 5:44525888-44525910 GGTTTCCTGCCCATCACTCCTGG + Intergenic
997364087 5:133314340-133314362 GGCTTGCTGCCCATGGCCCCCGG - Intronic
997743148 5:136275488-136275510 GGATTCAAGCCCAACACCACTGG - Intronic
999698155 5:154204345-154204367 GGATTCCTGCCACAGCCTCCTGG + Intronic
1001097947 5:168790370-168790392 GGTTAGCTGCCCCAGACCCCGGG - Intronic
1002621391 5:180491087-180491109 TGATTCCAGCCAAAGACCCAGGG - Intergenic
1005947195 6:30603168-30603190 GGCTTCCTCCCCCAGTCCCCTGG + Intronic
1006664063 6:35676860-35676882 GGAATCAGGCCCAAGACCCCTGG + Intronic
1007124883 6:39417592-39417614 TGTTTCCTGCCCAAGAGCCAAGG - Intronic
1007218794 6:40262322-40262344 AGATTCCTGTCCCAGCCCCCAGG - Intergenic
1011659460 6:89581749-89581771 GAATTCCTTCCCAAGATGCCTGG + Intronic
1012119561 6:95347673-95347695 GGATTCATGCCCAATCCCCCAGG - Intergenic
1018261667 6:161976452-161976474 GGAGTCCTGCCCATGAGTCCAGG + Intronic
1019056895 6:169230415-169230437 GGGCTCCAGCACAAGACCCCAGG - Intronic
1020354881 7:7265219-7265241 GGATTCTTACCCAAGCCTCCAGG + Intergenic
1022722091 7:32950521-32950543 GCATTCCTGCACAAGGGCCCAGG + Intergenic
1022912867 7:34917556-34917578 GGATTCCTGTCCAAATGCCCAGG - Intergenic
1023135948 7:37052103-37052125 GCATTGCTTCCCAAGAGCCCAGG - Intronic
1023914909 7:44581763-44581785 GTCTTCCTGCCCTCGACCCCTGG - Exonic
1024664140 7:51529054-51529076 GGGTTCTAGCCCAAGACCTCTGG - Intergenic
1026643873 7:72151212-72151234 AGATTCTTGCCCAAGGCCCTTGG - Intronic
1028018596 7:85744178-85744200 AGTTTCCTGCCCAAGACTCCTGG - Intergenic
1039462267 8:37755248-37755270 GAGTTCATGCCCAAGTCCCCAGG + Exonic
1046603130 8:116340912-116340934 CCATTCCTGCCCAAGCCACCTGG + Intergenic
1048857481 8:138697113-138697135 AGATTCCTGCCCCAGAGCCTAGG + Intronic
1048970746 8:139643758-139643780 AAATTCCTCCCCAGGACCCCTGG + Intronic
1048976248 8:139674592-139674614 GGACTCCAACCCAAGACCTCAGG + Intronic
1049243261 8:141549282-141549304 GGACTCATCCCCAAGTCCCCAGG - Intergenic
1049530797 8:143153855-143153877 GGATTGCTGCCCAGGACGCCAGG + Intergenic
1049804650 8:144533430-144533452 GAATTCCTGCCCCACACACCTGG + Intronic
1049826486 8:144671984-144672006 GGCTTTCTGCCCAAGGCCACTGG - Intergenic
1050959704 9:11713006-11713028 CCAGTCCTGCCCAAGACCTCAGG - Intergenic
1051400953 9:16681808-16681830 GGATTCCTGCCCAAAGTACCAGG - Intronic
1053421674 9:37983762-37983784 GGATCCGTGCCCGAGACGCCAGG + Intronic
1054156720 9:61645782-61645804 GGGGTCCTGCCCCAGATCCCGGG + Intergenic
1054859188 9:69931954-69931976 AGTTTCCCACCCAAGACCCCTGG - Intergenic
1057696543 9:97326732-97326754 GGCAGCCTGCCCAAGAGCCCAGG + Intronic
1061048969 9:128182984-128183006 CCATTCCTGTCCAAGACCTCAGG + Intronic
1061132086 9:128713950-128713972 GGATTACAGCCCAAGCCCCCAGG - Intronic
1061377566 9:130235294-130235316 CGTTCCCTGCCCCAGACCCCAGG - Exonic
1062322681 9:135998136-135998158 GGTGGCCTGCCCAAGGCCCCAGG + Intergenic
1062592827 9:137281688-137281710 GGACCCCTCCCCAAGACTCCAGG - Exonic
1203793881 EBV:165917-165939 GGACACCTGCACGAGACCCCTGG + Intergenic
1190506410 X:51130544-51130566 GGATTCCTCCAAAAGACTCCTGG - Intergenic
1199743531 X:150757538-150757560 GGACTCCTTCCCAACTCCCCAGG - Intronic
1200044746 X:153395539-153395561 ATATTCCTGCCCAGCACCCCTGG - Intergenic
1201859757 Y:18584131-18584153 GGAGTCCTTGCCAAGACCCGGGG + Intronic
1201873564 Y:18736250-18736272 GGAGTCCTTGCCAAGACCCGGGG - Intronic