ID: 1096585683

View in Genome Browser
Species Human (GRCh38)
Location 12:52618206-52618228
Sequence CCCGCCCGGGGGTATCCATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096585683_1096585690 -4 Left 1096585683 12:52618206-52618228 CCTGATGGATACCCCCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1096585690 12:52618225-52618247 CGGGCACAACGACGGACACACGG 0: 1
1: 0
2: 0
3: 3
4: 40
1096585683_1096585691 5 Left 1096585683 12:52618206-52618228 CCTGATGGATACCCCCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096585683 Original CRISPR CCCGCCCGGGGGTATCCATC AGG (reversed) Exonic
905856189 1:41316280-41316302 CCAGCTCGGGGCCATCCATCGGG - Intergenic
1076373679 10:129969853-129969875 CCCGCTCGGGCGCATCCAGCAGG - Intergenic
1077444076 11:2582250-2582272 CCTGCCCGGGGGTGGCCATGGGG + Intronic
1084171035 11:67401264-67401286 CGCCCCCGGAGGTATCCATGGGG - Intronic
1096579168 12:52573435-52573457 CCCACCTGGGGGCATCCACCAGG - Exonic
1096583109 12:52601155-52601177 CCCACCCGGGGGCATCCCTCAGG - Exonic
1096585683 12:52618206-52618228 CCCGCCCGGGGGTATCCATCAGG - Exonic
1098534672 12:71581250-71581272 CCCACCCCGGGGTATCTGTCTGG + Intronic
1115664494 14:35533538-35533560 TCCGCCCGCCGGTATCGATCGGG - Intergenic
1124971803 15:34495973-34495995 CCCGCCCGGGGGAGCCCACCTGG - Intergenic
1151555843 17:74846345-74846367 CCCTCCCGGGGGTGCCCAGCAGG - Intronic
1152744132 17:82031462-82031484 CCGGCCCGGGGGTCTCCTACGGG - Intergenic
1160716645 19:579798-579820 CCCTCCCTGGGGTTTCCCTCTGG - Intronic
1160812873 19:1020543-1020565 CCCGCCCGGGGACGTCCACCCGG - Intronic
1161961811 19:7527527-7527549 GCCGCTCGGGGGGATCCACCTGG - Exonic
1164189528 19:22901673-22901695 CGGGCCCGGGGGTGGCCATCTGG + Intergenic
948854384 2:240723366-240723388 CCCGCACGGTGGTGTCCATGTGG - Intronic
1168757368 20:326455-326477 CCCGCCCCGGGGTCTCGACCAGG - Exonic
1170934778 20:20800202-20800224 CCCTCCCGGGGATATGCCTCAGG + Intergenic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1185185670 22:49398246-49398268 CCGGCCAGGGGGTATGCAGCGGG - Intergenic
950008144 3:9704452-9704474 CCCGGCTGGGGGTAGCCATGGGG + Intronic
963046508 3:141106477-141106499 CACACCCTAGGGTATCCATCAGG + Intronic
964356231 3:155854241-155854263 GCTGCCCGGGGGTCTCCTTCAGG - Exonic
968811035 4:2799784-2799806 CCCCCCCGGGGGGATCCGTGAGG - Intronic
996716871 5:126595261-126595283 CCCGCCCGGGAGAACCCATTGGG + Exonic
1001429541 5:171648409-171648431 CCAGCCAGTGGTTATCCATCTGG - Intergenic
1002121372 5:177006811-177006833 CCCGCCGCGGGGGAGCCATCCGG + Intronic
1006054965 6:31377491-31377513 CCCGCCTGGGGGAGACCATCAGG + Intergenic
1015839274 6:137459608-137459630 CCCCTCAGGGGGTACCCATCAGG - Intergenic
1019475361 7:1241633-1241655 CCCGCGCGGGGGGTTCCGTCCGG - Intergenic
1029116660 7:98241169-98241191 CCTCCCCGGGGGTGTCCAGCAGG + Exonic
1037762730 8:21752597-21752619 CTCGTCCGGGGGTATAAATCTGG - Intronic
1040285248 8:46097488-46097510 CCCACCTGGGGGTACCCATGGGG - Intergenic
1053478023 9:38396030-38396052 CCCGCTCAGAGGCATCCATCCGG - Exonic
1057277612 9:93684361-93684383 CTTGCCAGGGGGCATCCATCAGG - Intergenic
1061207964 9:129175285-129175307 GCCGCCCCGGGGTCTCCAGCGGG - Intergenic
1187933536 X:24314555-24314577 CCCGCCTGGGGGTGTTCATGTGG + Intergenic
1199794035 X:151178154-151178176 CCTGCCCGGGAGAATCCAGCTGG - Intronic