ID: 1096585690 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:52618225-52618247 |
Sequence | CGGGCACAACGACGGACACA CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 44 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 40} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096585678_1096585690 | 20 | Left | 1096585678 | 12:52618182-52618204 | CCAGGAGGCTCTTGTTGATGGTG | 0: 1 1: 1 2: 1 3: 17 4: 166 |
||
Right | 1096585690 | 12:52618225-52618247 | CGGGCACAACGACGGACACACGG | 0: 1 1: 0 2: 0 3: 3 4: 40 |
||||
1096585683_1096585690 | -4 | Left | 1096585683 | 12:52618206-52618228 | CCTGATGGATACCCCCGGGCGGG | 0: 1 1: 0 2: 0 3: 1 4: 37 |
||
Right | 1096585690 | 12:52618225-52618247 | CGGGCACAACGACGGACACACGG | 0: 1 1: 0 2: 0 3: 3 4: 40 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096585690 | Original CRISPR | CGGGCACAACGACGGACACA CGG | Exonic | ||