ID: 1096585690

View in Genome Browser
Species Human (GRCh38)
Location 12:52618225-52618247
Sequence CGGGCACAACGACGGACACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096585678_1096585690 20 Left 1096585678 12:52618182-52618204 CCAGGAGGCTCTTGTTGATGGTG 0: 1
1: 1
2: 1
3: 17
4: 166
Right 1096585690 12:52618225-52618247 CGGGCACAACGACGGACACACGG 0: 1
1: 0
2: 0
3: 3
4: 40
1096585683_1096585690 -4 Left 1096585683 12:52618206-52618228 CCTGATGGATACCCCCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1096585690 12:52618225-52618247 CGGGCACAACGACGGACACACGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096585690 Original CRISPR CGGGCACAACGACGGACACA CGG Exonic