ID: 1096585691

View in Genome Browser
Species Human (GRCh38)
Location 12:52618234-52618256
Sequence CGACGGACACACGGACCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096585678_1096585691 29 Left 1096585678 12:52618182-52618204 CCAGGAGGCTCTTGTTGATGGTG 0: 1
1: 1
2: 1
3: 17
4: 166
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54
1096585685_1096585691 -6 Left 1096585685 12:52618217-52618239 CCCCCGGGCGGGCACAACGACGG 0: 1
1: 0
2: 1
3: 0
4: 32
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54
1096585687_1096585691 -7 Left 1096585687 12:52618218-52618240 CCCCGGGCGGGCACAACGACGGA 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54
1096585683_1096585691 5 Left 1096585683 12:52618206-52618228 CCTGATGGATACCCCCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54
1096585688_1096585691 -8 Left 1096585688 12:52618219-52618241 CCCGGGCGGGCACAACGACGGAC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54
1096585689_1096585691 -9 Left 1096585689 12:52618220-52618242 CCGGGCGGGCACAACGACGGACA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1096585691 12:52618234-52618256 CGACGGACACACGGACCCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096585691 Original CRISPR CGACGGACACACGGACCCCA AGG Exonic