ID: 1096589893

View in Genome Browser
Species Human (GRCh38)
Location 12:52651035-52651057
Sequence CTGGCTTTTCTCCTATTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096589893_1096589896 13 Left 1096589893 12:52651035-52651057 CCTTGAAATAGGAGAAAAGCCAG 0: 1
1: 0
2: 2
3: 31
4: 307
Right 1096589896 12:52651071-52651093 TGACACCAATAAAGACTTTATGG 0: 1
1: 0
2: 1
3: 21
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096589893 Original CRISPR CTGGCTTTTCTCCTATTTCA AGG (reversed) Intronic
900793263 1:4693120-4693142 CTGGATTTTCTCCCAGTTTATGG + Intronic
902212586 1:14914341-14914363 CTGGCTTTTCTCCTGTTGGTGGG - Intronic
902578246 1:17392093-17392115 CTGGCTTCTCTCCCATGGCAGGG + Exonic
903079288 1:20796244-20796266 CTGGCTTTGTTCCTAATTTAGGG - Intergenic
904396267 1:30224546-30224568 GTGCCTTTTCTCCCATCTCAGGG + Intergenic
904513277 1:31032372-31032394 CTAGCTTTTCTCCTTTATCATGG - Intronic
905719097 1:40180815-40180837 CTGTATTTTCTCCCATTTTATGG + Intronic
906134602 1:43488564-43488586 TTTACTTTTCTCCTATTTCTTGG + Intergenic
907283752 1:53367573-53367595 CTGGCTTTTCCCCTCTGTAAGGG - Intergenic
908610540 1:65855171-65855193 CTATCTTTTCTGCCATTTCAGGG + Intronic
908994857 1:70139485-70139507 ATGGCTTGTCTCCTACTTCCTGG + Intronic
911300086 1:96162009-96162031 CAGGATTTTCTCCTTTTTAAAGG - Intergenic
914436445 1:147664352-147664374 CTTTCCTTTCTCATATTTCATGG + Intronic
914696614 1:150088401-150088423 CAGGATTTTGTTCTATTTCATGG + Intronic
915465600 1:156096127-156096149 CTGGCTTTTCTCCACCTTCTGGG + Intronic
916010777 1:160703664-160703686 CTAGGTTTTCTCCTCTGTCATGG - Intronic
916098671 1:161374334-161374356 CTGGCTTTTGCCCCATTTCCTGG + Exonic
916126135 1:161572937-161572959 CTGTCTTTTCTTAGATTTCAGGG + Intergenic
916136053 1:161654778-161654800 CTGTCTTTTCTTAGATTTCAGGG + Intronic
916282106 1:163063285-163063307 TTGGGTTTTCTCCTACTTCTTGG + Intergenic
916338030 1:163695127-163695149 CTGGCTTTTCAGGTCTTTCACGG + Intergenic
916710615 1:167403426-167403448 CTGACTCTTCTTCTCTTTCAAGG - Intronic
917371640 1:174300216-174300238 CTGGCTTTTCAAATACTTCAGGG - Intronic
917553848 1:176063708-176063730 TTAGCTTTTGTCTTATTTCAGGG + Intronic
920436331 1:205949359-205949381 CTGCCTTTTCTCCTTTTGGAAGG + Intergenic
921126788 1:212185057-212185079 CTGACTTTTCTCCTAGTTATGGG - Intergenic
921542414 1:216432267-216432289 CTTGCTTTTCTCTTCTTTGAAGG - Intergenic
921611192 1:217214478-217214500 CTGACTTTTCTCCCTTTTAAGGG - Intergenic
921895825 1:220399502-220399524 CTGGCTTTGTTCCTTTTGCAAGG + Intergenic
1062871321 10:907644-907666 TTGGTTTTCCTCCCATTTCATGG + Intronic
1063598056 10:7455118-7455140 GTAGCTTTTATTCTATTTCACGG + Intergenic
1065064377 10:21945522-21945544 CTGGCTTTTCTCCCATATTTTGG - Intronic
1065835853 10:29657587-29657609 CTGGCTCTGCTCCTATGTAAAGG + Intronic
1066303620 10:34118134-34118156 CTGGCAATTCTCCTCTTTAAAGG + Intronic
1067328630 10:45293592-45293614 CTTGCTTTTGTCCTGTTTTAGGG - Intergenic
1067487255 10:46662302-46662324 CAGGCTTGTCTCCAATTTCTGGG + Intergenic
1067607550 10:47679706-47679728 CAGGCTTGTCTCCAATTTCTGGG - Intergenic
1068407489 10:56609438-56609460 TTGGCTTCTCTCCCGTTTCATGG + Intergenic
1069232522 10:66029288-66029310 CTCACTTTTCCTCTATTTCAGGG - Intronic
1069542449 10:69305432-69305454 CTGCCTTTTCTCCTAGTGCCTGG + Intronic
1069874782 10:71555176-71555198 CTTGGTTTCCTCCCATTTCATGG + Intronic
1071623104 10:87141067-87141089 CAGGCTTGTCTCCAATTTCTGGG - Intronic
1071756818 10:88551167-88551189 TTGGCTTTTCTTCTATATCTTGG - Intronic
1072467918 10:95684162-95684184 CTAGCTGTTCTCATATTTCTGGG - Intronic
1072598916 10:96904738-96904760 CTGGCTTTTCTGTGATATCATGG + Intronic
1073493807 10:103873325-103873347 CTGGATTTTCACATATTTCCAGG - Intergenic
1073740674 10:106402665-106402687 CTGGCTTTTCTCCTACTTTGAGG - Intergenic
1074405644 10:113178293-113178315 CTGGCTTGTGTTCCATTTCATGG + Intergenic
1074544051 10:114388684-114388706 CTGGATATTCTCCCATTTAAAGG + Intronic
1076545629 10:131244280-131244302 CTGGCATTTCTCATGCTTCACGG - Intronic
1077388585 11:2288198-2288220 CTGGCTTTTCTCCTGGTTCTGGG - Intergenic
1078118036 11:8475119-8475141 CTAGCTTTTCTCTGATTTCCAGG - Exonic
1078708982 11:13771847-13771869 CTGGCCTTTCTTCTTTTTTAAGG + Intergenic
1079962911 11:26945944-26945966 CTAGCTTTTCTACTAATTCATGG - Intergenic
1080783786 11:35455811-35455833 CTGGCATCTCTTCTATTTCAGGG - Intronic
1081744911 11:45466149-45466171 CTGGATTTCTTCCTATTTGAAGG + Intergenic
1084278014 11:68065893-68065915 CTGTCTTATGTCTTATTTCAGGG - Exonic
1085172862 11:74463596-74463618 CTGGCCTATCTTCTATTTCAAGG - Intronic
1085978904 11:81697147-81697169 CTTGCTTTTCTAGTACTTCACGG - Intergenic
1086300215 11:85420045-85420067 CTGGTTTTTCCCCATTTTCATGG + Intronic
1090140208 11:124250094-124250116 CTTGCTTTTCTCTGATTTTAGGG + Exonic
1090166299 11:124552382-124552404 CTCGCATTTCACCTTTTTCAGGG + Intergenic
1090320289 11:125837299-125837321 CTGGCCTTTCTCTTTTTTCAGGG - Intronic
1091156000 11:133373783-133373805 CTGCCTTTTCTCTTATGTTATGG + Intronic
1093478338 12:19579561-19579583 CTGGCTTTTCTCCTATCAAGAGG + Intronic
1094221237 12:27995862-27995884 GAGGCTTTTCTCCTAGTTCATGG + Intergenic
1096079117 12:48822266-48822288 CTGGGTTTCCTCCTCTGTCAGGG - Intronic
1096589893 12:52651035-52651057 CTGGCTTTTCTCCTATTTCAAGG - Intronic
1096660945 12:53123654-53123676 CTGGCTTCCCTCCCATTCCAGGG - Intronic
1097896472 12:64828883-64828905 CTGGCTTCTCACCTCCTTCAGGG - Intronic
1101327605 12:103729785-103729807 CTGGCTTTTTTCCTTCTGCAAGG - Intronic
1102215023 12:111154803-111154825 CTGGCTTCCCTGCTTTTTCATGG - Intronic
1102550839 12:113691021-113691043 CAGGATTTTATCCTTTTTCATGG - Intergenic
1103138577 12:118529044-118529066 CTTCCTTTTCTTCTTTTTCAGGG - Intergenic
1104729733 12:131098197-131098219 CTGCCTTCTCTGCTTTTTCAGGG + Intronic
1105441362 13:20417797-20417819 TTGCATTTTCTCCTACTTCACGG - Intronic
1108518944 13:51227607-51227629 CTGGCTGTCCTTCTATTTAAGGG - Intronic
1108705217 13:52979307-52979329 TTGGCTTTTCTTGTCTTTCATGG - Intergenic
1110050468 13:70890734-70890756 CTGTATTTTCACCTATATCATGG - Intergenic
1111409037 13:87850477-87850499 CTGGCTTTTCTCGTGTTTTGAGG + Intergenic
1111677454 13:91404498-91404520 CTGCCTTTTCTTCTAGTTGAAGG - Intronic
1112740446 13:102467171-102467193 CTGGCTTCACTCCAATTTTAGGG - Intergenic
1112821358 13:103340287-103340309 CTAGATTTTCTTCTGTTTCATGG + Intergenic
1112953253 13:105028962-105028984 TTGGCTTTTCTACTGTTTCTGGG + Intergenic
1113456832 13:110455294-110455316 CTGGCCTTCTGCCTATTTCAGGG + Intronic
1114188751 14:20424728-20424750 CTATCATTTCTCCTATTTCCTGG - Intergenic
1115002939 14:28443228-28443250 CTGGCTTTCTTCATCTTTCATGG + Intergenic
1116380549 14:44262212-44262234 CAGGATTTTATCCTTTTTCATGG - Intergenic
1116752774 14:48907679-48907701 CTGACTTTTGTCCTATTTCCTGG - Intergenic
1117013984 14:51499665-51499687 TTTGCTTTTCTCTGATTTCATGG - Intronic
1117274001 14:54174084-54174106 CAGGCCTCTCTCCTATTTCTTGG - Intergenic
1118524696 14:66625524-66625546 CTGCCTTTTGTCCTACTTCTTGG + Intronic
1119517327 14:75258651-75258673 CTGGTTTTGCTCCTGTCTCATGG + Intronic
1120846898 14:89134135-89134157 CTTGCTTTTCTCCTTTGTCTGGG - Intronic
1121527798 14:94631763-94631785 CTGGTTTTTCTACCATCTCAGGG + Intergenic
1125999242 15:44194516-44194538 CTGGCTTTTCTTATCTTTCTTGG - Intronic
1126750075 15:51867762-51867784 CTGCCTTGTCTCATATTTCTGGG - Intronic
1127951551 15:63812135-63812157 CTGGCTTTTCTCTTACTTGTAGG - Intronic
1129062141 15:72868629-72868651 CTGGCTTTTCTCTTGTGTCCTGG - Intergenic
1129235981 15:74224042-74224064 CTCGATTTTCTTTTATTTCAGGG + Intergenic
1130161138 15:81401459-81401481 CTGACTTTTCTCCAGTTCCAGGG + Intergenic
1131823579 15:96297289-96297311 CTGTCTTCTCTCCTCTATCAGGG - Intergenic
1137537842 16:49341005-49341027 CTGGCTTATCTTCTTTTTAAGGG - Intergenic
1138076846 16:54051160-54051182 CTGCCATTTCTCCTCCTTCAAGG + Intronic
1139048502 16:63093819-63093841 ATGGCTTCTCTCCCATTGCATGG - Intergenic
1139471714 16:67181442-67181464 CTGGCTTGTCCCCTATCTGAGGG + Intronic
1140407898 16:74723279-74723301 TTGGCTTTTCTCCTCTTCCCTGG + Intronic
1140622191 16:76748434-76748456 ATGGCATTTCTATTATTTCAGGG - Intergenic
1140861490 16:79022389-79022411 CTGGCTTATCTGTTATTTCTTGG + Intronic
1141122289 16:81369359-81369381 CTGCATTTTCTACTCTTTCATGG - Intronic
1141315306 16:82957033-82957055 CTGGCTTCCCTCTTATTTTATGG + Intronic
1141379180 16:83560339-83560361 CAGGATTTTCTCCTTTTTAAAGG - Intronic
1141820047 16:86439446-86439468 CTGGCTTTGCTTTTATTTTATGG + Intergenic
1143990335 17:10954175-10954197 CTGTCTTTTCTACTAGATCAAGG - Intergenic
1144187911 17:12813845-12813867 CTGGCATTTCTCCTGGCTCACGG + Intronic
1144250693 17:13413807-13413829 GTGGCCTTTCTCCTTCTTCATGG - Intergenic
1147481801 17:40772141-40772163 CTGGCTTTGCTCCTCTTTCTGGG - Exonic
1147590896 17:41682725-41682747 CTCTCTTTCCTCCTTTTTCAGGG - Intergenic
1148659524 17:49317488-49317510 ATGGCTGTTCTTCTGTTTCATGG + Exonic
1148892093 17:50815620-50815642 CTGGCTTTCCTCCTATTCACCGG + Intergenic
1149554809 17:57565819-57565841 CTTGCTATTCTCCTCTTTCTCGG + Intronic
1149735858 17:58992907-58992929 CTGGCCTTTGTCCTAGTTCCTGG - Intronic
1150307624 17:64099893-64099915 CTGTCCTTTCTCCCATTCCAGGG - Intronic
1153066823 18:1055224-1055246 CAGGATTTTCTTCTATTTTATGG + Intergenic
1154507909 18:15060819-15060841 CTGACTTTGCTCCTATCTCCTGG - Intergenic
1156315984 18:35969132-35969154 GTGGCATTTCTCCTATGCCATGG + Intergenic
1156440664 18:37184251-37184273 TTGTATTTTCTCCTATTTTAAGG + Intronic
1156520113 18:37715005-37715027 CAGACTTTTCTCCTCTTCCATGG + Intergenic
1156605166 18:38657883-38657905 CTGGTTTTTCTCAATTTTCAAGG + Intergenic
1157070129 18:44396950-44396972 CTGGCATTTCTCCTATTAGGAGG - Intergenic
1157370676 18:47108784-47108806 CTGGCTTTACTTTCATTTCAGGG - Exonic
1157457182 18:47842959-47842981 TGGGCTTTTCTCATATTTGAAGG - Intronic
1157658394 18:49416172-49416194 CTGACTTTGCTCTTCTTTCAAGG - Intronic
1158808372 18:61002341-61002363 GTTTTTTTTCTCCTATTTCAAGG - Intergenic
1158947215 18:62457462-62457484 CTGGCTTTTCTCCTCCTCCGGGG + Intergenic
1160970093 19:1764181-1764203 CTGGCTTTGCTCCTGTTTGAGGG + Intronic
1161023559 19:2023728-2023750 CTGGCTTCTCTCTGTTTTCATGG - Intronic
1164427144 19:28151652-28151674 GTGTCTTTTCTCCAATTTCAAGG + Intergenic
1167188179 19:47962888-47962910 ATGGCTTTTCTCCCAGTTCCAGG - Intergenic
1167689015 19:50974343-50974365 GTGCTTTTTCTCCCATTTCAAGG + Intergenic
925436767 2:3845119-3845141 TTGGCTTCTCTCCTCTTTAAGGG + Intronic
925727574 2:6888609-6888631 CTTGGTTTTCTCCTATCTCATGG + Intronic
926498595 2:13622589-13622611 ATGGCTTGTGTCGTATTTCATGG - Intergenic
926593358 2:14762908-14762930 CTTGGTTTTCTCATATTTAAGGG - Intergenic
926986050 2:18624956-18624978 CTGTCAATTCTCCTATTTAAAGG + Intergenic
927596335 2:24401237-24401259 CTGGCTTTTGTCTTAGTTCAGGG - Intergenic
928558554 2:32452590-32452612 ATGGCTTTTCTGCCACTTCAAGG + Intronic
928719852 2:34107564-34107586 CTAGATTTTCTCCTATGTTATGG + Intergenic
930598958 2:53422457-53422479 GTGGCTTTTGTCATATTTGATGG - Intergenic
930772728 2:55143914-55143936 CAGGATTTTCTTCTTTTTCAAGG - Intergenic
931237925 2:60427429-60427451 GTGTCTTTTCTCCTCTTTCTGGG - Intergenic
931882587 2:66582345-66582367 CTGTTTTTCCTCCTATTTCTAGG - Intergenic
933362874 2:81310196-81310218 CTGTCTCTTCTTCTCTTTCAGGG - Intergenic
933867951 2:86540876-86540898 CTGGCTTTTCTCCTGTTTTGGGG + Intronic
935452469 2:103225686-103225708 CTGGATTTTCTTATATTTAATGG - Intergenic
936171460 2:110180663-110180685 CTGGCTTTTCTACATTCTCATGG - Intronic
936494987 2:113011045-113011067 CTGGATTTTCTTCTTTTTAAAGG + Intergenic
937745412 2:125406611-125406633 CTGGATTTTCTCCTATGGCTTGG + Intergenic
938592328 2:132751596-132751618 CAGCCTGTTCTCCTATTTCAAGG + Intronic
940050945 2:149464167-149464189 CTGGCTTTTCTTCTAGATCATGG - Intronic
940567778 2:155389781-155389803 CTGTCTTTTCTCCTATCTGCTGG + Intergenic
940835764 2:158519743-158519765 ATGCCTTTTCTATTATTTCATGG + Intronic
943058891 2:183017351-183017373 CTTGCTTTCCTGCAATTTCATGG + Intronic
943376178 2:187079463-187079485 CTGGCTTTTCTATTGTTTCAAGG + Intergenic
946005352 2:216520217-216520239 CTGTCTTCTCTCCTTTTTCTGGG + Intronic
947808747 2:232986520-232986542 CAGGATTTTCTCCTTTTTTATGG - Intronic
1169215013 20:3788194-3788216 CTGGTTTTTCTCCTGCTTCAGGG - Intronic
1169826343 20:9772767-9772789 GAGACTTTCCTCCTATTTCAAGG + Intronic
1174089572 20:48036261-48036283 CTGGCTCCTCTCCTATGTCCAGG - Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1176790173 21:13310980-13311002 CTGACTTTGCTCCTATCTCCTGG + Intergenic
1176985981 21:15436677-15436699 CTGGCTTTTCCCTTTCTTCAGGG + Intergenic
1177989351 21:28019189-28019211 CTGACTTTGCTCCTATCTCCTGG + Intergenic
1178018773 21:28384650-28384672 TTGGTTATTCTCCTATCTCAAGG - Intergenic
1178620572 21:34170553-34170575 TTAGTTTTTCTTCTATTTCATGG + Intergenic
1179350280 21:40604029-40604051 CTCCCTTTTCTCCTTTTTCTGGG + Intronic
1183025248 22:35060448-35060470 CTGGATTTCCTTCTTTTTCAAGG - Intergenic
1184285421 22:43468382-43468404 CTGGCCTGTCTCCAGTTTCAGGG + Intronic
1184623972 22:45707892-45707914 GTGGGTTTTCTCCAATTTCCAGG - Intronic
1184954315 22:47873505-47873527 CTGGCTTTTCTCCAGAATCATGG + Intergenic
949751142 3:7354071-7354093 CTGGCTTCTCTTTTATTCCAGGG - Intronic
951806666 3:26652135-26652157 CTGACTTTTCTTCCATTTCATGG - Intronic
952015385 3:28950659-28950681 CTGGCTTTTCTTTTATTTCTTGG + Intergenic
953122632 3:40060063-40060085 CTTGCTTTTGTCCTATATCTGGG - Intronic
954479758 3:50788049-50788071 GTGGCTGTTCTTCTGTTTCATGG + Intronic
954578253 3:51688709-51688731 CACGCTTTTCTCCAATTTGATGG - Intronic
955353880 3:58214610-58214632 CTTGCTTTTCTCAAATTCCAAGG - Intronic
955390272 3:58517551-58517573 CTGCCTTTTCTCCTAGCTCTGGG + Intronic
955668384 3:61375064-61375086 CTTGTTATCCTCCTATTTCATGG - Intergenic
956489687 3:69757618-69757640 CTGGCTCTTCCCCAAGTTCAGGG - Intronic
957459689 3:80500646-80500668 CTCGCTTGTCTCCTTTTACATGG + Intergenic
957729201 3:84110645-84110667 CTGGCTTTTCTCCCCTTTTGTGG + Intergenic
960391782 3:117085668-117085690 GTGGCTTTTACCCTAGTTCATGG + Intronic
960815117 3:121664043-121664065 CTGTATTTTCTCCTGTTTCAGGG - Exonic
960929061 3:122825810-122825832 CTGGCCTCTTTTCTATTTCAAGG + Intronic
961140189 3:124549484-124549506 ATCACTTTTCTCCTATTTTATGG - Intronic
961258273 3:125577099-125577121 ATGGCTTTTCTCATACTGCAAGG - Intronic
961278693 3:125747754-125747776 TTGGTTTTCTTCCTATTTCAGGG + Intergenic
961407498 3:126692066-126692088 CTGACTTTTATTCTATTCCAGGG + Intergenic
962118828 3:132540948-132540970 CTGGTTTTTATCTTATTGCAAGG - Intergenic
963009501 3:140755941-140755963 CTGTCTCTTCTCCTATTATAAGG + Intergenic
963703297 3:148654156-148654178 CTAGCTTCTCTCCTATTGCCAGG - Intergenic
965025481 3:163296929-163296951 CTGGCTTTACACCCTTTTCAGGG - Intergenic
965866754 3:173214627-173214649 CTGGCTTTTCCCCAATTCCCTGG - Intergenic
966180269 3:177181752-177181774 CTGGCTTTTTTTCTGATTCATGG - Intronic
966352426 3:179045181-179045203 CTGGTTTTTATCTTATTTCATGG - Intronic
967468337 3:189833776-189833798 CTGGCTTTTCTATTTTTTCCTGG - Intronic
967515942 3:190368661-190368683 ATGGATATTCTCCTATTTCCTGG + Intronic
967951850 3:194847444-194847466 CTGGGATTTTTCCTATCTCAAGG + Intergenic
968074233 3:195807748-195807770 GTGTCTTTTCTCTGATTTCACGG - Intronic
968661540 4:1800767-1800789 CTGGTTTTTCTCCTTCCTCAGGG - Intronic
969392752 4:6902017-6902039 CTGGCTGTTCTCAGATCTCATGG - Intergenic
969418444 4:7075986-7076008 CTGGCTTTCCTTCTGTTGCAAGG - Intergenic
970169989 4:13279778-13279800 CTGTCTGTTCTCCTAATTTAGGG - Intergenic
970498994 4:16657643-16657665 CTGGCTTTCCTTCTGTTTCTTGG + Intronic
970876648 4:20878383-20878405 CTGGCTTTCCTTTTATTTTAAGG + Intronic
971253867 4:24996082-24996104 CAGGCTTTCCTCTTCTTTCAGGG + Intergenic
972347903 4:38209021-38209043 CTGGTTTCTCTCCTCTGTCAGGG - Intergenic
974003384 4:56532336-56532358 CTGCCTTTTCTCATATTTCAGGG + Intronic
974504575 4:62752146-62752168 GTGGCTGTTTTCCTATCTCAGGG - Intergenic
974628660 4:64455530-64455552 TTTGTTTTTTTCCTATTTCATGG + Intergenic
974633961 4:64534233-64534255 ATTGCTTTTCTCCCATTTCTTGG - Intergenic
976369323 4:84268705-84268727 CTGGCTTTCCTCCTATTAGCTGG + Intergenic
977381038 4:96273795-96273817 CTTGCTTTTCTAGTTTTTCAAGG - Intergenic
977403044 4:96559354-96559376 TTAGATTTTCTCCCATTTCAAGG + Intergenic
981908578 4:149952462-149952484 AAGGATTTTCTCATATTTCAAGG + Intergenic
982156000 4:152521569-152521591 CTGACTTTTCTGCTATTTACAGG - Intronic
982225865 4:153165816-153165838 CTGTGTATTCTCATATTTCATGG + Intronic
982291249 4:153784860-153784882 CTTGCTTTTATCCTTTTCCAAGG - Intronic
982317662 4:154047930-154047952 CAGTGTTTTCCCCTATTTCATGG + Intergenic
982467549 4:155749046-155749068 CTGGCTTAGCTACTATTTCCTGG - Intergenic
983900767 4:173131461-173131483 ACGGCTTTTCTCTTTTTTCAAGG - Intergenic
983925033 4:173391427-173391449 TTGGTCTTTCTTCTATTTCAGGG - Exonic
984136067 4:175940980-175941002 CTGGCTGGTCTTCCATTTCATGG + Intronic
985074496 4:186200026-186200048 CTGGCTATTCTCCTATAACCAGG - Intronic
986363712 5:7007803-7007825 CTGGCTTTCCTCCTACTTCTTGG + Intergenic
986678200 5:10207832-10207854 CTCTCTTTTTTCCTATATCATGG + Intergenic
986704912 5:10446822-10446844 CAAGGTTTTCACCTATTTCATGG - Intronic
987608763 5:20174950-20174972 ATTGCTTTTCTAGTATTTCACGG - Intronic
989119612 5:37991246-37991268 CTGCCTTTTCTCATATTTCCTGG - Intergenic
990283142 5:54273224-54273246 CTGGCTTTACCCCAAATTCATGG - Intronic
992258357 5:74944901-74944923 CTGTCTTTCCTCCTAGTACAGGG + Intergenic
993921590 5:93811510-93811532 CCGGTTTTTCACGTATTTCAGGG - Intronic
994358673 5:98825262-98825284 TTGGTTTTTCTCTTATTTTATGG - Intergenic
994470466 5:100198407-100198429 CTGGATTTGCTTCTATTTCCTGG + Intergenic
994802939 5:104402107-104402129 CTGGCTTATCTTTTATTCCATGG - Intergenic
994838158 5:104884075-104884097 CTGGCTTTTCACTTTTTTGATGG - Intergenic
996285255 5:121783578-121783600 CTAAATTTACTCCTATTTCAAGG - Intergenic
997043251 5:130282104-130282126 TTGGCTTTTCTCCTCTTTTGGGG + Intergenic
997204180 5:132031986-132032008 CTGGGTCTTCTCCCATTTCCTGG - Intergenic
997630752 5:135367187-135367209 CAGGCTTTTCTGCTGTTTCTGGG + Intronic
997804699 5:136905602-136905624 CTGGCTTTTCTTCTCTTTTGAGG + Intergenic
998653038 5:144142622-144142644 CTGCCTCTTCTCCTACTTCTGGG + Intergenic
998682770 5:144488552-144488574 CTGGCTGGTCTCCTATTTGAAGG + Intergenic
999043539 5:148443359-148443381 ATGGCCTTTCTCCCCTTTCAAGG + Intergenic
999053292 5:148547145-148547167 CAGGTTCATCTCCTATTTCATGG - Intronic
999468775 5:151832178-151832200 CTGGCTTTTCCTCTTCTTCATGG - Intronic
999910329 5:156190715-156190737 CTGGCTTTATTCCTATTAAAAGG - Intronic
999955421 5:156696259-156696281 CTGGAACTTCTCCTAATTCATGG - Intronic
1000112881 5:158126018-158126040 CTTGGTCTTCTCTTATTTCATGG + Intergenic
1000726129 5:164773177-164773199 CTGGCTTTTCTTCTATCTATTGG - Intergenic
1000751292 5:165099148-165099170 CAGGATTTTCTTCTTTTTCAAGG + Intergenic
1003863093 6:10339751-10339773 CTGAGTTTCCTCCTATTTCACGG + Intergenic
1005579668 6:27221718-27221740 CTTTCTTTTCTCCACTTTCATGG + Intergenic
1006608242 6:35275190-35275212 CTGGATTTGCTCCTAGTTCTGGG + Intronic
1007445484 6:41902308-41902330 CTGGCTTTCCTCAGATATCAAGG - Intergenic
1008274776 6:49530140-49530162 CTGGCTTTCCTCCTATCTTCTGG - Intergenic
1009318331 6:62253027-62253049 GTGGCTTTTCTCTTGTTCCATGG + Intronic
1010073359 6:71770848-71770870 CTGGCTTTCCTCAACTTTCAGGG + Intergenic
1010308831 6:74358451-74358473 ATGGATTTTAGCCTATTTCAAGG - Intergenic
1010744860 6:79549091-79549113 ATGGCATTTCTGTTATTTCACGG - Intergenic
1010885379 6:81231659-81231681 CTGTATTGTCTCCTTTTTCATGG - Intergenic
1013904172 6:115195650-115195672 CTGGGCTTTCTCCTATCTGAAGG - Intergenic
1016401917 6:143690036-143690058 TTGGCATTTCTGCTATTACATGG - Intronic
1017725879 6:157275454-157275476 CTGTCTTTTCTCCTTTTACAAGG + Intergenic
1019208310 6:170381920-170381942 ATTGCTTTTCTCCAATATCAGGG + Intronic
1020687631 7:11315359-11315381 CTCACTTTTCTCATATCTCACGG - Intergenic
1022456116 7:30559721-30559743 CTGGCTTCTTTCCTGTTTCCAGG + Intergenic
1022674843 7:32489775-32489797 CTGGCTTGTGTGCTATTTGAAGG + Intronic
1023583219 7:41703909-41703931 CCAGCTTTACCCCTATTTCAAGG - Intergenic
1026317893 7:69243198-69243220 CTGGCTTTCTTCCCATTTGAAGG - Intergenic
1028406375 7:90479021-90479043 AAGTCTTTTCTCCTATTTCTTGG - Intronic
1031117113 7:117680621-117680643 CTACCTTTTCTCCTACTTCTAGG - Intronic
1031637050 7:124114262-124114284 TTGTCTTTTCTCATTTTTCATGG - Intergenic
1031773886 7:125881962-125881984 CTTCCTTTTCTCTTATTTCAGGG - Intergenic
1031821365 7:126506163-126506185 CAGGCTTTTCTTCTTTTTTAAGG + Intronic
1031928815 7:127663882-127663904 CTGACTTTTTTCCTATTTGCTGG + Intronic
1032054987 7:128677070-128677092 CTGACTCTTCTCCAATTTCCAGG - Intronic
1032731026 7:134643203-134643225 CTGGCTCTTTTCCTATGCCAAGG + Intergenic
1033607778 7:142940027-142940049 CTGGCTTTTGTCATGCTTCAAGG + Intronic
1035025554 7:155822892-155822914 GTTGTTTTCCTCCTATTTCAAGG + Intergenic
1035449086 7:158963842-158963864 TAGACTTTTCTCCTATTTCTGGG - Intergenic
1036291343 8:7494410-7494432 CTGTCTTTTCTTATATTTCTAGG + Intergenic
1036330146 8:7817126-7817148 CTGTCTTTTCTTATATTTCTAGG - Intergenic
1036575839 8:10027077-10027099 CTTGCCTCTCTCCTACTTCAGGG + Intergenic
1037226434 8:16597316-16597338 CTGGATTCTCTCCTAGTTAAAGG - Intergenic
1038060056 8:23902660-23902682 CTGGCTTGATTCCTATTTTAAGG + Intergenic
1039946702 8:42135866-42135888 CTGTCTTTTCTCCAATTTTCTGG - Intergenic
1040942449 8:52846549-52846571 CTGGTTATTCTCCTAGTTGATGG - Intergenic
1041592575 8:59606607-59606629 CTGACTTTTCTCCGATTTTTGGG - Intergenic
1042371195 8:67992331-67992353 CTGGTTTTTCTCTATTTTCATGG + Intronic
1043172794 8:76986446-76986468 CTGGCTGCTCTCCTCTCTCATGG + Intronic
1044179687 8:89175330-89175352 TTCTCTTTTCTCATATTTCAGGG - Intergenic
1044294572 8:90512316-90512338 CTAGCTTTTCCCCTTTTTCCTGG - Intergenic
1044680742 8:94775011-94775033 CAGGATTTTCTTCTTTTTCAAGG + Intronic
1045196442 8:99935633-99935655 CAGGATTTTCTTCTATTTTAAGG - Intergenic
1045870877 8:106925550-106925572 GTGGCTATTCTCAGATTTCAAGG - Intergenic
1050439525 9:5646736-5646758 CTGTATTTTCTTCTGTTTCAAGG + Intronic
1050795918 9:9541399-9541421 ATGGCGTCTCTCCTATTTCTGGG - Intronic
1052463456 9:28797918-28797940 CTGGTTTTTCTCCTGCCTCATGG - Intergenic
1054797821 9:69318860-69318882 CTTGTTTTTCTGCTATTCCAGGG + Intergenic
1055523889 9:77110500-77110522 CTGGCCTTTGTCCTGGTTCATGG - Intergenic
1055958357 9:81795417-81795439 CTGAGTTCTCTCCTATTTCCGGG - Intergenic
1056760885 9:89414322-89414344 CTGGCTTATTTCTTATCTCAGGG + Intronic
1057898504 9:98929252-98929274 ATGGCTTTTTCCATATTTCAGGG + Intergenic
1059902195 9:118940606-118940628 CTTGCAGTTCTGCTATTTCATGG - Intergenic
1062720633 9:138041430-138041452 CTTCATTGTCTCCTATTTCAGGG + Intronic
1185844535 X:3425312-3425334 CTGGCTTTTCTCATCTCTGAGGG - Intergenic
1186121403 X:6366236-6366258 CCGGTTTTTCTCTTTTTTCAGGG + Intergenic
1186342563 X:8659633-8659655 CTTTCTTTTCTCTTTTTTCAGGG + Intronic
1187860057 X:23673447-23673469 CTGCCTTTCTTCTTATTTCAAGG - Intronic
1187960996 X:24565801-24565823 TTGCCTTTTTTCTTATTTCATGG - Intronic
1188055508 X:25536397-25536419 ATGGCTTGCCTCCTATTCCATGG - Intergenic
1188569047 X:31560150-31560172 ATGGCTTCTCTTCTCTTTCAAGG + Intronic
1189106374 X:38239845-38239867 CTGTCTCTTCTTCTAATTCAAGG - Intronic
1190389091 X:49913814-49913836 CTGGATTTTCTCCTATCTCATGG - Intergenic
1192895715 X:75440942-75440964 CTGGCTTTTCTCCACTTCCCTGG - Intronic
1193085020 X:77441281-77441303 TTGGCTTTCATCCTATTTCTGGG - Intergenic
1194083145 X:89492753-89492775 CTGGATTTTATCCTTTTTTATGG + Intergenic
1195704271 X:107727415-107727437 GTGGCATTACTCCCATTTCAGGG - Intronic
1196123502 X:112075589-112075611 CAGGATTATCTCCTATTTTAAGG - Intronic
1196837829 X:119829622-119829644 CTGGTTTTTCTCCTATTCTCTGG + Intergenic
1196930611 X:120677636-120677658 TTGGCTTCTCTACTATTTCATGG + Intergenic
1196978737 X:121188150-121188172 CTGGATTTACTCCTATCTCATGG - Intergenic
1197450085 X:126601867-126601889 CTGTCTATTCTCCCATCTCAGGG + Intergenic
1197787281 X:130211591-130211613 TTTGCTTTTCCCCTACTTCAAGG - Intronic
1197897297 X:131328699-131328721 CTGGCTTTCCTCCTGTTAAAAGG - Intronic
1197948614 X:131869899-131869921 CTGGATTTGCTTCTCTTTCATGG - Intergenic
1198074051 X:133177881-133177903 CTGGCTTTCTCCTTATTTCATGG - Intergenic
1198552597 X:137760531-137760553 GTGGATTTTCTCCTCTCTCAGGG + Intergenic
1200435795 Y:3148626-3148648 CTGGATTTTATCCTTTTTTATGG + Intergenic