ID: 1096591641

View in Genome Browser
Species Human (GRCh38)
Location 12:52663939-52663961
Sequence GGGTGGGTTGATGGTAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096591641_1096591651 29 Left 1096591641 12:52663939-52663961 CCCAAATTACCATCAACCCACCC No data
Right 1096591651 12:52663991-52664013 CTCCCCTTGACTGATGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096591641 Original CRISPR GGGTGGGTTGATGGTAATTT GGG (reversed) Intergenic
No off target data available for this crispr