ID: 1096596337

View in Genome Browser
Species Human (GRCh38)
Location 12:52698175-52698197
Sequence ATGGATAAATTGAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 440}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096596337_1096596344 3 Left 1096596337 12:52698175-52698197 CCCTCCACACTCAATTTATCCAT 0: 1
1: 0
2: 4
3: 45
4: 440
Right 1096596344 12:52698201-52698223 AACGTAAGGAAATGGTGTTTCGG 0: 1
1: 0
2: 0
3: 10
4: 176
1096596337_1096596341 -5 Left 1096596337 12:52698175-52698197 CCCTCCACACTCAATTTATCCAT 0: 1
1: 0
2: 4
3: 45
4: 440
Right 1096596341 12:52698193-52698215 TCCATGCCAACGTAAGGAAATGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096596337 Original CRISPR ATGGATAAATTGAGTGTGGA GGG (reversed) Intronic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900754390 1:4423626-4423648 AAGGATAAATCAAGTGTGTAAGG + Intergenic
900816321 1:4849236-4849258 ATAGATAAATGGACAGTGGATGG - Intergenic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006612 1:6174771-6174793 ATGGATAGATGGTGGGTGGATGG + Intronic
901054282 1:6441426-6441448 ATGGATAAAGTGAGTCTGCGGGG + Intronic
903341678 1:22658800-22658822 ATGGATGGATGGAGGGTGGATGG + Intronic
903418932 1:23204419-23204441 ATGAAAAAAATGAGTGTGGCCGG - Intergenic
903730431 1:25490178-25490200 ATGAAAAAATTGATTGGGGAAGG + Intronic
904115086 1:28155776-28155798 AAGGATCAATTGAGCCTGGAAGG + Intronic
904304093 1:29575833-29575855 AAAGAAAAATTGTGTGTGGAGGG - Intergenic
904391050 1:30186365-30186387 ATGAATAAATAGGGGGTGGATGG - Intergenic
905228240 1:36493849-36493871 ATGGATAAGTGGTGGGTGGACGG - Intergenic
906449638 1:45933966-45933988 ATGGGTAAATTGTGTGTTGTGGG + Intronic
906888849 1:49684955-49684977 ATGGGTAAATTGCATGTGGCTGG + Intronic
906916606 1:50017827-50017849 ATGGATAAATTGCATGTTGCTGG - Intronic
906957168 1:50384014-50384036 ATGGGTAAATTGCGTGTTGCTGG + Intergenic
907534017 1:55131974-55131996 CTGGATATACTGAGTCTGGATGG - Intronic
907968658 1:59358905-59358927 ATGAAGAAATTGAGGATGGAGGG + Intronic
908639774 1:66209618-66209640 ATGTATAATTTGAGTGGGGGTGG - Intronic
908852261 1:68387528-68387550 AAGGAGAAATGGAGGGTGGAAGG - Intergenic
909875030 1:80791091-80791113 ATAGATAAATTGTGTGTTGCAGG - Intergenic
911380928 1:97113446-97113468 ATGAATAAATTGAGTTTGGGGGG + Intronic
911411888 1:97520373-97520395 ATGAATCAGTTGAGTTTGGAAGG - Intronic
911759935 1:101602520-101602542 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
912599490 1:110914248-110914270 ATGGGTAAATTGTGTGTTGCTGG - Intergenic
913399758 1:118418252-118418274 ATAGATAAATTGTGTGTCAAAGG - Intergenic
915244880 1:154549593-154549615 TTGAATGAATTGAGTGGGGATGG - Exonic
916298505 1:163247176-163247198 GTGGATAAATTGTGTGTTGCTGG - Intronic
916546032 1:165805316-165805338 ATGGATAAATTGCATGTTGCAGG - Intronic
917058938 1:171016076-171016098 ATGGATACCTTGAGTCTGGGCGG - Intronic
918200718 1:182264066-182264088 ATGGATTAATGGGTTGTGGAGGG + Intergenic
918541297 1:185636101-185636123 ATGGATAAATGGAGGGAGGGAGG - Intergenic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
919195410 1:194278625-194278647 ATAGATAAATTGTGTGTTGTGGG - Intergenic
919426761 1:197442033-197442055 ATGTATAAAGTATGTGTGGATGG + Intronic
919515600 1:198518400-198518422 AAAGACAAAATGAGTGTGGAAGG - Intergenic
919703983 1:200658604-200658626 GTGGATCACTTGAGTGTGGGAGG + Intronic
921670767 1:217921515-217921537 ATGAATAAACTGAGGATGGAAGG + Intergenic
921992002 1:221376947-221376969 ATAGATAAAATGAGGGGGGATGG + Intergenic
922845609 1:228681784-228681806 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
923472268 1:234302468-234302490 ATGGAGAACTTGAGCGTAGATGG + Intronic
924413692 1:243834675-243834697 ATGGGTAAATTGCGTGTTGAGGG - Intronic
1062929563 10:1343966-1343988 ATGGGTAAATTGTGTGTTGTGGG - Intronic
1062943747 10:1444522-1444544 ATGGATGGATTGTGAGTGGATGG - Intronic
1062943838 10:1444975-1444997 ATGGATGGATTGTGAGTGGATGG - Intronic
1062991985 10:1827923-1827945 ATGGGTAAATTGAGTGTCACTGG - Intergenic
1063240616 10:4165741-4165763 ATGGACTAATTAAGTGTGAATGG - Intergenic
1063500446 10:6548962-6548984 ATGGATAAATGGATCATGGATGG - Intronic
1063616735 10:7606675-7606697 ATGGATAAATTGTGTGTTGAGGG - Intronic
1064599204 10:16976058-16976080 AAGGATCACTTGAGGGTGGAAGG - Intronic
1066369539 10:34808786-34808808 ATGGATAAATTGGTTGTGGAGGG - Intronic
1067656096 10:48192720-48192742 ATGGATAACTTCAACGTGGACGG - Exonic
1068131130 10:52896749-52896771 AGGTTTAAATTTAGTGTGGAGGG - Intergenic
1069429836 10:68324595-68324617 ATAAATAAATAAAGTGTGGAGGG - Intronic
1071426296 10:85557314-85557336 ATTGGGAAATAGAGTGTGGATGG - Intergenic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071575554 10:86723323-86723345 ATGGATAAATGGAGGAGGGAAGG + Intronic
1071721527 10:88151458-88151480 ATGGAGTAATTGATTCTGGATGG - Intergenic
1072971634 10:100022394-100022416 ATGGACAAAATGAGTCTGGTTGG - Intergenic
1074979358 10:118607497-118607519 ATAGGTAAATTGAGTGTTGTGGG + Intergenic
1075308346 10:121389104-121389126 ATGGGTAAATTGTGTGTTGTGGG - Intergenic
1076095374 10:127730961-127730983 ATGATTAAATTTAGTGAGGAAGG - Intergenic
1076845004 10:133065654-133065676 ATGGATAGATGGAGGGTGGATGG + Intergenic
1077280527 11:1743014-1743036 ATGGATGGATTGAGGGTGGATGG + Intronic
1078039665 11:7848234-7848256 AGGGAGAGATTGAATGTGGATGG - Intergenic
1078333330 11:10444123-10444145 GTGGATGTATTGAGTGTTGATGG + Intronic
1078355196 11:10627671-10627693 TTGGATGATTTGAGTGTGGGGGG - Intronic
1078445653 11:11403192-11403214 TTGGATAAACTAACTGTGGAAGG - Intronic
1079427233 11:20355267-20355289 AAGGAGAAATTCACTGTGGAAGG - Intergenic
1080147247 11:29001654-29001676 ATTATTAAATTAAGTGTGGAAGG - Intergenic
1080689425 11:34544018-34544040 ATGGATAAATTATGTGTTGCAGG - Intergenic
1081207170 11:40289930-40289952 ATGTATACATTAAGTGTGGAGGG + Intronic
1081366256 11:42239014-42239036 AAGGTGAATTTGAGTGTGGAAGG + Intergenic
1082217992 11:49597933-49597955 ATGGGTAAATTGTGTGTTGTGGG + Intergenic
1082859339 11:57839170-57839192 ATGGGTAAATTGTGTGTTGCAGG - Intergenic
1084705134 11:70811703-70811725 ATGGATAAATGAATGGTGGATGG - Intronic
1084841497 11:71854628-71854650 ATGGATAAATTGTGTGTCCTGGG - Intergenic
1085398707 11:76221831-76221853 ATGGATAAATTGCATGTTGTGGG - Intergenic
1085505600 11:77056876-77056898 ATGGCTGAATTGGGTGTGCAAGG - Intergenic
1085944697 11:81254197-81254219 ATGGAGAAAATGTGTGTGGTAGG + Intergenic
1086132670 11:83417868-83417890 ATGGCTAAATTGAATGTCGTGGG - Intergenic
1086401994 11:86468422-86468444 ATGGATAAATCAAGGATGGATGG - Intronic
1086631579 11:89026255-89026277 ATGGGTAAATTGTGTGTTGTGGG - Intronic
1087202969 11:95364699-95364721 TTGGATAAATTGAGAGTGGGTGG - Intergenic
1088234912 11:107712755-107712777 TTGGATAGATTGGGAGTGGAAGG + Intronic
1088277284 11:108101232-108101254 CTGGATATATTGAGTGTGAGAGG + Intronic
1089061461 11:115629499-115629521 ATGGAGAAATTGGGTGGGAAGGG - Intergenic
1089472228 11:118730614-118730636 AAGGAGGAATTGAGGGTGGAAGG + Intergenic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1094722577 12:33079489-33079511 ATAGATAAATTGAGTGTCATGGG + Intergenic
1094790648 12:33910384-33910406 AGGGATTACTTGAATGTGGAGGG - Intergenic
1095463720 12:42468671-42468693 ATGGAAAAATTCACTGTGGCAGG - Exonic
1096346855 12:50856141-50856163 ATGGGTAAACTGTGTGTGGCAGG - Intronic
1096596337 12:52698175-52698197 ATGGATAAATTGAGTGTGGAGGG - Intronic
1096760176 12:53835195-53835217 ATGGATAAACTAAGAGAGGAGGG - Intergenic
1096912083 12:54994601-54994623 ATGGGTAAATTGGGTGTTGCGGG + Intergenic
1096941702 12:55354025-55354047 TTGAATAAATTGTATGTGGATGG - Intergenic
1097319948 12:58214339-58214361 ATGGGTAAATTGCGTGTTGTAGG + Intergenic
1098902732 12:76129804-76129826 ATGGGTAAATTGTGTGTTGCAGG + Intergenic
1098968393 12:76820455-76820477 TTAGATGAATTGAGTTTGGAAGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099404161 12:82239569-82239591 ATGGGTAAATTAAGTGTTGCTGG + Intronic
1099758052 12:86880470-86880492 ATGGATACTTTGAATGTGCAAGG - Intergenic
1100107609 12:91196016-91196038 ATGGATTAATTGAGTAGGCAAGG - Intergenic
1100452742 12:94722983-94723005 AAGGATAGATTGAGTGGGGAGGG - Intergenic
1100548153 12:95622731-95622753 AAGGATAGATTGAGTCTGGGAGG + Intergenic
1100928634 12:99580289-99580311 ATGGGTAAATTGTGTGTTGCTGG - Intronic
1101005204 12:100395094-100395116 ATGGACCAACTGATTGTGGAAGG + Intronic
1101067331 12:101035941-101035963 ATGGGTAAATTGTGTGTTGGGGG - Intronic
1101231625 12:102747407-102747429 ATGGATAAATTGCGTGTCACAGG + Intergenic
1101780771 12:107832938-107832960 ATGGATAAACAGTGAGTGGACGG + Intergenic
1102222970 12:111207046-111207068 ATGGATAAATGGATGGTGGTTGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102514528 12:113437419-113437441 ATGGATAGATGGACAGTGGATGG + Intronic
1102974112 12:117193813-117193835 CTGGATAAGTTGAGTTTGAAGGG - Intergenic
1103020209 12:117527799-117527821 TTGGATAAATGGAGTGTCGTGGG + Intronic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1104232388 12:126897902-126897924 ACGGATGAGTTGAGTCTGGATGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104527926 12:129541507-129541529 ATGGCTAAATTGGGAGGGGATGG + Intronic
1104906848 12:132218064-132218086 ATGGATAAATGGTGGATGGATGG - Intronic
1105249008 13:18679274-18679296 ATGAAGAAAGTGAGTGTGAATGG + Intergenic
1106195090 13:27486730-27486752 ATAGATAAGTTGAGTGGGTATGG - Intergenic
1107517852 13:41149214-41149236 TTAAAAAAATTGAGTGTGGAGGG + Intergenic
1108900422 13:55398011-55398033 ATGGATAAATTGATTATCAATGG - Intergenic
1109869484 13:68314548-68314570 ATGGGTAAATTGTGTGTTGTTGG - Intergenic
1109905744 13:68838571-68838593 ATTAATGAATTGAGTGTTGAGGG - Intergenic
1110259185 13:73466173-73466195 ATAAATAAACTGAGTCTGGATGG + Intergenic
1110802746 13:79718656-79718678 AGGGATGATTTGAGGGTGGAAGG - Intergenic
1111065234 13:83082472-83082494 ATGGCTAAACTTAGTGAGGAAGG - Intergenic
1112345132 13:98583039-98583061 ATGGAACAATGGAATGTGGAAGG + Intergenic
1112978919 13:105356943-105356965 ATGATTAAGTTTAGTGTGGAAGG + Intergenic
1113335666 13:109373639-109373661 ACATATAAATTGTGTGTGGAGGG + Intergenic
1115898746 14:38120652-38120674 ATGTGGAAATTGTGTGTGGAAGG - Intergenic
1116075565 14:40106075-40106097 ATGTTTAAATAGAGTGTGTATGG - Intergenic
1116612857 14:47100304-47100326 ATGGATAGAATGAGGGTGGTTGG - Intronic
1116738240 14:48721868-48721890 ATGGGTAAATTGAGTGTCAAGGG - Intergenic
1116753817 14:48921067-48921089 ATGGGTAAATTGGGTGGGGGGGG + Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1118426465 14:65669110-65669132 ATAGATAAATTGTGTGTCGTGGG - Intronic
1118435596 14:65768095-65768117 ATGGATAAATTGTGTGTCCTGGG + Intergenic
1118504271 14:66393459-66393481 ATGGGTAAATTGCATGTTGAGGG + Intergenic
1119997797 14:79272320-79272342 ATGTATAAATTTAGTGTTCATGG + Intronic
1120336109 14:83157156-83157178 ATGGATAAATTCTGTGTTGTAGG - Intergenic
1120415339 14:84212566-84212588 ATGGATAAATTGTGTGTCACTGG + Intergenic
1120698468 14:87671104-87671126 ATGAATAAATTGAATGTTGCTGG - Intergenic
1120817325 14:88875913-88875935 ATGAAAAAAATGAGTGAGGAAGG - Intronic
1121504995 14:94470261-94470283 ATGGATAAAGAATGTGTGGAGGG - Intronic
1122029898 14:98904717-98904739 ATGGATAAATAGACAGTGGATGG - Intergenic
1122166871 14:99832243-99832265 ATGGATAAATAAACTGTGGTAGG - Intronic
1122484448 14:102069275-102069297 AAGGGTGCATTGAGTGTGGATGG + Intergenic
1123160011 14:106268978-106269000 ATAGAAAAATTGAGTGTGAATGG - Intergenic
1123207652 14:106728532-106728554 ATAGAAAAATTGAGTGTGAGTGG - Intergenic
1123986233 15:25648706-25648728 ATGGATAAATTGCATTTGTATGG + Intergenic
1127143406 15:56000014-56000036 ATGGGAAAATTGAGAGTGGGTGG - Intergenic
1128396209 15:67229081-67229103 ATGGGTAAATTGTGTGTTGCTGG - Intronic
1128565303 15:68697107-68697129 ATGGATGGATGGATTGTGGATGG + Intronic
1128726752 15:69993696-69993718 ATGCTTGACTTGAGTGTGGAAGG - Intergenic
1128808586 15:70553419-70553441 ATTGATTGATTGATTGTGGAGGG + Intergenic
1133869752 16:9675938-9675960 AAGGAGAAATGGAGGGTGGAAGG + Intronic
1134153870 16:11826707-11826729 GAGGATCACTTGAGTGTGGAAGG - Intergenic
1134224556 16:12380854-12380876 ATGGATAGATGGTGGGTGGATGG - Intronic
1135670700 16:24373198-24373220 ATTGATTAATTGAGAGTGGTGGG - Intergenic
1135954868 16:26948084-26948106 ATGGGTAAATTGCGTGTCGTGGG - Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137580049 16:49628087-49628109 ATGGGTAGATGGAGGGTGGATGG - Intronic
1137973094 16:53005226-53005248 ATGGAAAAGTGGAGTATGGATGG + Intergenic
1140319330 16:73933190-73933212 ATGGATAAATTGTGTATTGCGGG - Intergenic
1140917140 16:79504595-79504617 ATGGATAAATGGATAGAGGATGG + Intergenic
1141430288 16:83967760-83967782 ATGGATGGATGGAGGGTGGATGG + Intergenic
1141866469 16:86753264-86753286 AGGGATAAAATGTGTGTGGGGGG - Intergenic
1142244761 16:88964981-88965003 ATGGATAAATAGATGGTGGGTGG - Intronic
1142324870 16:89408278-89408300 AAGGCTAAAGTGAATGTGGAAGG - Intronic
1143759879 17:9093450-9093472 ATGGATCACTTGAGTCTGGTAGG - Intronic
1144140065 17:12339654-12339676 AAGAACAAATTAAGTGTGGAAGG - Intergenic
1146755421 17:35427924-35427946 ATGGTTAAATCGAGTATGGGAGG + Intronic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1148116364 17:45177684-45177706 ATGGATAAATACAGTTTGAAGGG - Intergenic
1149716380 17:58794460-58794482 ATAGATAAATTGCGTGTTGTGGG + Intronic
1150305329 17:64079815-64079837 ATGGAGGAATAGAGAGTGGAGGG + Intronic
1150702653 17:67461178-67461200 ATGGACACAGTGAGTGTGGATGG - Intronic
1151056578 17:71038618-71038640 ATGGGTAAATTGAGTGTTCCAGG + Intergenic
1152255289 17:79235485-79235507 ATGGATAAATGGGGTAAGGATGG - Intronic
1153035944 18:762430-762452 ATGGGTAAATTGTGTGTTGTGGG - Intronic
1153135157 18:1909313-1909335 AGGGATAATGTGAGAGTGGAGGG - Intergenic
1153140032 18:1960673-1960695 ATGGCTAAATTGCGTGTCGCTGG - Intergenic
1153631699 18:7076702-7076724 CTGGGAAAATTGAATGTGGATGG + Intronic
1153712381 18:7812776-7812798 ATGGAGAAATTGGGTCTGGATGG + Intronic
1154170929 18:12049477-12049499 TTGGATAAAGTGAGTGTTAATGG - Intergenic
1154439873 18:14379955-14379977 ATGAAGAAAGTGAGTGTGAATGG - Intergenic
1155343302 18:24834728-24834750 ATGAATAAATTAAGTGTGGCTGG - Intergenic
1156120526 18:33837167-33837189 TTGGAGATATTGAGTGGGGATGG - Intergenic
1156635043 18:39017651-39017673 ATGATTAAATTTAGTGAGGAAGG - Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1157018055 18:43743600-43743622 ATGGGTAAATTGTGTGTTGCTGG - Intergenic
1157191502 18:45585977-45585999 ATGGATTAATTGGGTGTGTTGGG + Intronic
1158101784 18:53837736-53837758 ATGGGTAAATTGTGTGTTGCAGG - Intergenic
1158768336 18:60483765-60483787 ATGGAAAGATTGAGTGTGTGGGG - Intergenic
1159688526 18:71456165-71456187 ATGGATAAATTGTGTGTCGCTGG + Intergenic
1161498907 19:4602546-4602568 ATGGATGAATGGATTATGGATGG + Intergenic
1161498951 19:4602763-4602785 ATGGATATATGGATTATGGATGG + Intergenic
1161498988 19:4602912-4602934 ATGGATATATGGATTATGGATGG + Intergenic
1161499035 19:4603181-4603203 ATGGATATATGGATTATGGATGG + Intergenic
1162062747 19:8106864-8106886 ATGGATGTATTGAGGATGGATGG + Intronic
1162184355 19:8892972-8892994 ATGGTAAAATTGAGGGTGAATGG + Exonic
1162184757 19:8896048-8896070 ATGGTGAAGTTGAGTGTGAATGG + Exonic
1163816473 19:19467979-19468001 CTACATAAATTGAGGGTGGAGGG + Intronic
1164059008 19:21649321-21649343 ATGGATAAATTGAGAGAAGTAGG - Intergenic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1165665854 19:37627368-37627390 ATGGGTAAATTGTGTGTTGTAGG + Intronic
1166201414 19:41239966-41239988 ATAGATATATGGAGGGTGGATGG + Intronic
1166201474 19:41240232-41240254 GTGGATATATGGAGGGTGGATGG + Intronic
1166201482 19:41240263-41240285 TTGGATATATGGAGGGTGGATGG + Intronic
1166542648 19:43615614-43615636 GAGGATAAATTGAGCCTGGAAGG + Intronic
1168029148 19:53665895-53665917 GTGGATCACTTGAGTCTGGAAGG - Intergenic
926072045 2:9904170-9904192 ATGGGTAAATTGAGTGTGGTGGG + Intronic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
926698619 2:15787868-15787890 ATGGATAGATAGAGGATGGATGG - Intergenic
926850172 2:17187942-17187964 ATGAATAAACTGAGGATGGAAGG + Intergenic
927313166 2:21652952-21652974 ATGGAAAAATGGAGTTTGAAAGG + Intergenic
927728512 2:25448319-25448341 ATGAATAAAATGAGTGTGTGTGG + Intronic
928661668 2:33508131-33508153 ATTGAGAAATTGAGAGTGGAGGG + Intronic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
930243475 2:48959617-48959639 ATGGATAAATCCAGAGTGAATGG - Intergenic
931028380 2:58140499-58140521 ATGCACAAATAGAGTGTGGAGGG + Intronic
931683880 2:64776324-64776346 ATGAATAAACTTAGTGAGGAAGG - Intergenic
932159611 2:69448136-69448158 AAGGAGGAATGGAGTGTGGAAGG + Intergenic
932962027 2:76423878-76423900 CTGGATCAATTGAGCTTGGAAGG + Intergenic
933377832 2:81502678-81502700 ATGTATATATTTAGTGTAGAAGG + Intergenic
933495467 2:83045246-83045268 ATGGATGAATTGTGTGTGCATGG + Intergenic
935087160 2:99859092-99859114 AGTGCTAAATTGAGTTTGGATGG + Intronic
935369705 2:102332423-102332445 ATGGATAAACAAAGTGTGGTAGG + Intronic
936669742 2:114643372-114643394 GTGGATAAACTAAGTGTGCATGG - Intronic
936906572 2:117542292-117542314 TTGGTTAAATTGTGTGTGAAAGG - Intergenic
936936018 2:117838933-117838955 ATTGATAAAGTCAGTGAGGAAGG + Intergenic
938108155 2:128547176-128547198 ATGGATAGATGGAGAATGGATGG - Intergenic
939522279 2:143246054-143246076 GAGGAAAAAATGAGTGTGGAGGG + Intronic
940113618 2:150182880-150182902 ATGGATAGACTGTGTGTGCATGG + Intergenic
942468510 2:176234160-176234182 ATGGATAAATGGACTCTGGAAGG + Intergenic
942829235 2:180219445-180219467 ATGGATAAATTGTGTGTCATGGG - Intergenic
942842243 2:180376850-180376872 ATGGATATATTGAGTTTGTTCGG + Intergenic
942929867 2:181477067-181477089 ATAGATAAATTGCGTGTTGTAGG - Intronic
943184619 2:184591631-184591653 ATGGATAAATTAATTTTGGTAGG + Intergenic
944143326 2:196480269-196480291 AAGTATAAACTGTGTGTGGAAGG - Intronic
944940274 2:204617611-204617633 ATGGGTAAATTGTGTGTTGCAGG + Intronic
945315203 2:208363074-208363096 ATGGATAAATTGTGTGTCATGGG + Intronic
945432879 2:209785368-209785390 ATAGATAAACTGAGTGAGCATGG + Intronic
946751865 2:222900181-222900203 ATGGCTTAATTGAATGTGGCTGG + Intronic
947675030 2:231971224-231971246 ATGGGTAAATTGTGTGTTGTCGG + Intronic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947812766 2:233014841-233014863 ATGGATAGATGGTGGGTGGATGG - Intronic
947812850 2:233015182-233015204 ATGGATAGATGGTGGGTGGATGG - Intronic
948262526 2:236614759-236614781 ATGGGGGAATTGAGTGTGTAAGG + Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169467659 20:5855674-5855696 ATGGATAAATAAAATGTGGTTGG - Intronic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170420314 20:16186179-16186201 ATCCATAAATTGAGTCTGAAAGG + Intergenic
1171045412 20:21805788-21805810 ATGAAAAAATGAAGTGTGGATGG - Intergenic
1171508606 20:25660873-25660895 ATGGAAAAATTGAGCCTGGGAGG - Intergenic
1172230822 20:33334381-33334403 ATGGTTAGATGGACTGTGGATGG + Intergenic
1173374717 20:42473063-42473085 ATGGATAAACTGGGTGTTGCGGG - Intronic
1173772391 20:45672784-45672806 ATGGATAAATTGTGTGTTGTGGG - Intergenic
1174277107 20:49411913-49411935 CTGAAAAAATTTAGTGTGGAAGG + Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1176455872 21:6909816-6909838 ATGAAGAAAGTGAGTGTGAATGG + Intergenic
1176834046 21:13774864-13774886 ATGAAGAAAGTGAGTGTGAATGG + Intergenic
1178183292 21:30189467-30189489 ATAGATAAATTGTGTGTTGAGGG - Intergenic
1178280886 21:31281816-31281838 ATGGATAGAGTGATAGTGGATGG + Intronic
1178917564 21:36716642-36716664 ATGCATATATTCTGTGTGGAAGG - Intronic
1180850406 22:19016471-19016493 ATGGAAAAATGGCCTGTGGATGG - Intergenic
1182039109 22:27222533-27222555 GTGGATAGATGGAGAGTGGATGG + Intergenic
1182048531 22:27295904-27295926 ATGGATAAATGGACAGTGGATGG + Intergenic
1182890128 22:33811076-33811098 ATGGGTAAATTGGGTGTTCAGGG + Intronic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
949361951 3:3241912-3241934 ATGTATTAATTGACTGTGGTAGG + Intergenic
949964182 3:9341339-9341361 AAGGAGCACTTGAGTGTGGAGGG - Intronic
950057776 3:10041102-10041124 GAGGATCAATTGAGCGTGGAAGG + Intronic
950085724 3:10256261-10256283 AAGGATTGCTTGAGTGTGGAAGG - Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950783579 3:15413480-15413502 GTGGATCACTTGAGTCTGGAAGG + Intronic
952257939 3:31711558-31711580 ATGGGAAACTTGAGTGTGCAAGG + Intronic
952621299 3:35346388-35346410 ATGGATAAAGAGAGAGTGCAAGG + Intergenic
952725004 3:36574340-36574362 ATGTCTAAACTAAGTGTGGAGGG - Intergenic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953721209 3:45356778-45356800 ATGGGTAAATTGTGTGTGGCTGG + Intergenic
953848380 3:46446710-46446732 ATTCATCATTTGAGTGTGGATGG - Intronic
955122096 3:56070923-56070945 ATGGCTAAATTGAGAGATGAGGG - Intronic
955829077 3:62982285-62982307 ATGAATAAAAGGTGTGTGGAAGG - Intergenic
956163077 3:66374917-66374939 ATGATTAAATTTAGTGAGGAAGG + Intronic
958073497 3:88645447-88645469 ATGGATGAATTGTGTGGAGAGGG - Intergenic
959058061 3:101587980-101588002 ATGGAGAAATTGACTGGGCATGG + Intronic
959825123 3:110784948-110784970 AAGGATAAATTGTGTGTTGCTGG + Intergenic
959864805 3:111253731-111253753 ATGGGTAAGTTGTGTGTGGAGGG + Intronic
960176365 3:114522391-114522413 ATGGGGAAATTGAATATGGAGGG + Intronic
961009865 3:123428545-123428567 ATGGTTAGATTGAGAGTGGAGGG - Intronic
961142224 3:124565233-124565255 ATGATTAAATTGGGAGTGGAGGG - Intronic
961245291 3:125446341-125446363 ATGGGTAAATTGTGTGTTGCTGG + Intergenic
962338413 3:134559800-134559822 AAGGAGAAAGGGAGTGTGGAGGG + Intronic
963190393 3:142464500-142464522 ATAGATAAATAAAATGTGGATGG + Intronic
963411180 3:144930157-144930179 ATGGGTAAATTGAGTGTCGCTGG - Intergenic
963425067 3:145114211-145114233 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
963456814 3:145555622-145555644 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
964606400 3:158565004-158565026 ATGGATAAATTGTGTGTCACAGG + Intergenic
965716706 3:171612492-171612514 AAGGATGAATTGAGTTGGGAGGG - Intronic
966071494 3:175884722-175884744 ATGGATGAATTGAGGGAGGTAGG - Intergenic
966077042 3:175949065-175949087 ATAGGTAAATTGCGTGTTGAGGG - Intergenic
966567470 3:181398893-181398915 ATGGAAAAATTGATGATGGATGG + Intergenic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
967566960 3:190984770-190984792 ATGGGTAAATTGCGTGTTGCTGG + Intergenic
968146299 3:196301750-196301772 ATGTAAAAATAGAGTGGGGAGGG + Intronic
968594547 4:1475544-1475566 ATGGATCAGTGGTGTGTGGATGG + Intergenic
969654256 4:8487293-8487315 ATGGAGGAATGGAGGGTGGAAGG + Intronic
969782591 4:9420670-9420692 ATGGATAAATTGTGTGTCCTGGG - Intergenic
969866726 4:10081134-10081156 ATGGATAAATTGGTTGTCCAAGG - Intronic
970048558 4:11884160-11884182 AAGGAAAGATAGAGTGTGGAAGG + Intergenic
970246725 4:14071831-14071853 ACTGATAAATTGAGGGAGGAGGG + Intergenic
971882301 4:32392666-32392688 ATGGATAAATTGTGTGTCATAGG - Intergenic
972175576 4:36401821-36401843 AGGGACTACTTGAGTGTGGAGGG - Intergenic
972659730 4:41104533-41104555 CTGGATAAATTGTGTGTCGTGGG + Intronic
972967598 4:44530679-44530701 ATAGATAAATTGTGTGTTGTGGG + Intergenic
973716669 4:53683662-53683684 AAGGACAATGTGAGTGTGGAAGG + Intronic
973902364 4:55489033-55489055 ATGGATAAATGGATAGTGTAAGG - Intronic
974746226 4:66081313-66081335 AAGGAAAAATTGTGTGTAGAAGG + Intergenic
974903630 4:68031862-68031884 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
974941975 4:68480852-68480874 ATGGGTAAATTGTGTGTTGCTGG + Intronic
977266636 4:94863272-94863294 ATAGATAAATTGTGTGTCGTAGG - Intronic
977839214 4:101681369-101681391 ATGGATAAATAAACTTTGGACGG - Intronic
978391445 4:108230537-108230559 ATGGGTAAATTGTGTGTTGCAGG + Intergenic
978402792 4:108348911-108348933 ATGGGTAAATTGTGTGTTGTGGG + Intergenic
978429910 4:108622887-108622909 AAAGATAGATGGAGTGTGGAAGG + Intronic
979190073 4:117845944-117845966 ATGATTAAATTTAGTGAGGAAGG + Intergenic
979273990 4:118794128-118794150 ATACATAAATTGAGTGGGTATGG - Intronic
979633156 4:122925891-122925913 ATGAATAAATGAAGGGTGGATGG + Intronic
980155108 4:129094788-129094810 AAGGGAAAATTGAGTGTGCAAGG + Intronic
980171356 4:129293990-129294012 ATGAATATATGGAGTGTGGAAGG + Intergenic
980303737 4:131028311-131028333 ATGGATAAAATTAGTGTAGTTGG - Intergenic
980514107 4:133831257-133831279 ATGGGTAAATTGTGTGTTGCAGG - Intergenic
980635881 4:135502059-135502081 ATGGGTAAATTGTGTGTCGTAGG - Intergenic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
983922167 4:173357746-173357768 AAGGACAAATAGAGTGTGTATGG + Intergenic
985057546 4:186048666-186048688 AAGGAGGAATTGAGGGTGGAAGG + Intergenic
985662960 5:1166439-1166461 ATGGATGAATGGTGGGTGGATGG - Intergenic
986020466 5:3796802-3796824 ATGGATGAATTGAGAGTGGGTGG + Intergenic
988850515 5:35175808-35175830 AAGAAGAAAGTGAGTGTGGAAGG - Intronic
989056283 5:37368929-37368951 ATCGATAACTTTAGTGAGGATGG + Intronic
990026368 5:51195815-51195837 ATGGGTAAATTGCGTGTCGCTGG + Intergenic
990573760 5:57105116-57105138 ATGGATAGTTTGGGTATGGAAGG + Intergenic
992995326 5:82327152-82327174 ATGGGTAAATTGCGTGTTGTGGG + Intronic
994709454 5:103248870-103248892 ATGGGTAAATTGCGTGTCGCTGG - Intergenic
995013196 5:107280658-107280680 ATGGATATATTTTGTGTGGATGG + Intergenic
995293186 5:110484245-110484267 ATGGGTAAATTGTGTGTTGATGG - Intronic
995584128 5:113629251-113629273 ATGAATAAAGTGATTCTGGAAGG - Intergenic
995904439 5:117106522-117106544 ATGGAGAGATTGAGCATGGATGG + Intergenic
996032629 5:118722798-118722820 ATGGGTAACTTGAGTGAGCAGGG - Intergenic
996237289 5:121147229-121147251 ATGGGTAAACTGAGTGTTGGGGG + Intergenic
996434713 5:123422087-123422109 TTGGTTAAATTCAGTGTGGTTGG - Intronic
996527902 5:124498288-124498310 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
996605433 5:125315093-125315115 TTAGATAAACTGAGTGGGGAAGG + Intergenic
997019649 5:129984079-129984101 ATGGGTAAATTGTGTGTTGCGGG + Intronic
997041614 5:130263018-130263040 ATGGATAAATTGCATGTTGCTGG + Intergenic
997066206 5:130562441-130562463 ATGGATAAATTGTGTGTCATGGG - Intergenic
997320101 5:132970840-132970862 AAGGATAAATTGAGCCTGGGAGG + Intergenic
997438971 5:133895734-133895756 ATGGAAAAAATGAGTATTGATGG - Intergenic
998582603 5:143394922-143394944 ATGAATTAATTGGGGGTGGAGGG - Intronic
999071113 5:148745085-148745107 ATGGATAAATTGCATGTTGCAGG - Intergenic
999597936 5:153226238-153226260 ATGGATAAATTGTGTGTCACAGG + Intergenic
999714982 5:154353322-154353344 ATGATTAAATTGAGTATGGTAGG - Intronic
999795743 5:154988182-154988204 AAGGATCAATTGAGTCTGGGAGG + Intergenic
1000132252 5:158310859-158310881 ATGGATAAATTGTGTGTTATAGG - Intergenic
1003783117 6:9451629-9451651 ATGGATACATTAAGTGTTTAAGG - Intergenic
1005199154 6:23323529-23323551 ATGGGTAAATTGTGTGTTGTGGG - Intergenic
1008799602 6:55350333-55350355 ATGTATAAATTGATAATGGATGG - Intronic
1009497375 6:64367991-64368013 ATAGGTAAATTGTGTGTGGTGGG + Intronic
1010080109 6:71851803-71851825 ATGGGTAAATTGTGTGTCGCAGG + Intergenic
1010579842 6:77582142-77582164 CTGAATCAATTGACTGTGGAGGG + Intergenic
1010610327 6:77946635-77946657 ATGGATAAATTGTGTGTTGCTGG + Intergenic
1010659434 6:78552340-78552362 ATGGGTAAATTGAGTGTCACAGG + Intergenic
1014741413 6:125151748-125151770 ATGATTAAATTTAGTGAGGAAGG + Intronic
1014812741 6:125904571-125904593 ATGGTTAAACTGGGTGTTGAGGG - Intronic
1015187539 6:130435341-130435363 ATGGAAACATTAAGTGTGGCTGG + Intronic
1015410130 6:132884977-132884999 GAGGATCACTTGAGTGTGGAGGG + Intergenic
1016077182 6:139809963-139809985 ATGGGTAAATTGTGTGTTGTGGG - Intergenic
1017518690 6:155182167-155182189 TTGGAGAAATTCAGTGTGGTGGG + Intronic
1019057809 6:169235794-169235816 GTGGATGGAGTGAGTGTGGATGG - Intronic
1019057976 6:169236539-169236561 GTGGATAGAGTGAGTGTGGATGG - Intronic
1019058015 6:169236740-169236762 GTGGATGGAGTGAGTGTGGATGG - Intronic
1019326876 7:442835-442857 ATGGATGGATGGATTGTGGATGG + Intergenic
1021292921 7:18868220-18868242 ATGGGTCAATTGAGTGTGTGTGG + Intronic
1021611956 7:22466270-22466292 ATGGATAAATTGTGTGGCGTGGG + Intronic
1021733032 7:23615575-23615597 ATGATTAAATTTAGTGAGGAAGG - Intronic
1022225021 7:28354134-28354156 ATGTCTAAATTAAGTATGGAAGG + Intronic
1023086756 7:36578525-36578547 ATGGAAAAATGGAGAGTGGAGGG - Intronic
1023571317 7:41575495-41575517 ATGGATAAATTGCGTGTCTCTGG + Intergenic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1025091832 7:56070538-56070560 GAGGATCACTTGAGTGTGGAAGG + Intronic
1027389835 7:77693958-77693980 TGGCATAAGTTGAGTGTGGAAGG + Intergenic
1027645615 7:80794212-80794234 GTGGATAAATTGAGTAAGGAAGG - Intronic
1030541492 7:110836077-110836099 TTGCATAAATTGGGAGTGGAGGG + Intronic
1030613945 7:111718074-111718096 ATGGGTAAATTACGTGTGGCTGG + Intergenic
1031922589 7:127612755-127612777 ATGGATGAATGGAGGATGGATGG + Intronic
1032587000 7:133156117-133156139 ATGGGTAAATTGAGTGTTGCTGG - Intergenic
1032663509 7:134012040-134012062 ATGGATGAAGTGAGTGAGCAGGG + Intronic
1034033800 7:147798927-147798949 TTGGATAAATTCAATATGGAGGG - Intronic
1034510487 7:151530637-151530659 ATGGGTATATTGGGTGTAGATGG - Intergenic
1035288644 7:157822822-157822844 ATGGATAGATGGATAGTGGATGG - Intronic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1036662985 8:10720301-10720323 ATGGATGGATGGAGAGTGGATGG + Intergenic
1036836473 8:12073456-12073478 ATGGATAAATTGTGTGTCCTGGG + Intergenic
1037669734 8:21004055-21004077 ATGGATAGATGGAGGATGGATGG + Intergenic
1038141157 8:24846828-24846850 TTAGAGAAATTGAGTGTTGATGG - Intergenic
1038533898 8:28340069-28340091 ATGGACAAATGGCTTGTGGAAGG - Intronic
1038967529 8:32591884-32591906 ATGGGTAAATTGAGTGTTGCAGG - Intronic
1038989958 8:32857396-32857418 AGGGATAAATGGAGGGGGGAGGG - Intergenic
1039192316 8:34990628-34990650 ATGATTAAATTTAGTGAGGAAGG + Intergenic
1040492776 8:47940447-47940469 ATGGATAAGTTGGCAGTGGAAGG - Intronic
1040773545 8:51010718-51010740 ATGGATATATTGAGTGATGCTGG + Intergenic
1041391847 8:57353935-57353957 AAGGATCACTTGAGTGTGGGAGG - Intergenic
1041463877 8:58140034-58140056 ATGGACACAGTGGGTGTGGAGGG + Intronic
1042419062 8:68563680-68563702 AGGGACAAACTGAGTGTTGATGG - Intronic
1042939127 8:74089739-74089761 ATGGATAAATGGGGGGTGGGGGG + Intergenic
1042964281 8:74334361-74334383 ATGGACAAATAGACTGTAGATGG - Intronic
1043415909 8:80048930-80048952 ATGGACAAAGTGACTGTGAAAGG + Intronic
1043850129 8:85206435-85206457 AGGGATCAACTGTGTGTGGAAGG + Intronic
1044321374 8:90805429-90805451 CTGGATAAATTGGGTGGGGTGGG + Intronic
1046255216 8:111687882-111687904 AGGGATTACTTGAGGGTGGAGGG - Intergenic
1047548415 8:125842509-125842531 ATGGATAAATTGCATGTTGTGGG - Intergenic
1048126831 8:131645170-131645192 ATGGATAAATTGTGTGTTGCTGG - Intergenic
1048618489 8:136105789-136105811 ATGGAGAAATTGAGAGTTGAAGG + Intergenic
1049364244 8:142229055-142229077 ATGGATAAATGGTGGGTGGGTGG + Intronic
1049364258 8:142229114-142229136 ATGGATAAATGGATGGTGGGTGG + Intronic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1049797367 8:144502919-144502941 CTGGTTAAATTTAGTGTGGGGGG + Intergenic
1049868970 8:144958745-144958767 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
1051048796 9:12907194-12907216 ATGAATAAATTGGCAGTGGAAGG - Intergenic
1053720673 9:40943824-40943846 AGAGAAAAATTAAGTGTGGAAGG + Intergenic
1054345315 9:63908331-63908353 AGAGAAAAATTAAGTGTGGAAGG - Intergenic
1055212307 9:73811535-73811557 ATGGTTAAATAGAGTTTGAATGG + Intergenic
1055361948 9:75501037-75501059 ATGGTTAAATTGCGTGTTGTGGG + Intergenic
1056008355 9:82298883-82298905 ATTGATAAGTTGTGTGTGTATGG + Intergenic
1057981931 9:99671425-99671447 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
1058006649 9:99923177-99923199 ATGGGTAAATTGTGTGTTGCTGG + Intronic
1058571660 9:106352748-106352770 ATGGATAAATTGAGTGTCTCAGG + Intergenic
1059978232 9:119740888-119740910 ATGGGTAAATTGTATGTGGCTGG + Intergenic
1061938412 9:133871308-133871330 ATGGATGAATTGGGGGTGGATGG + Intronic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1203454462 Un_GL000219v1:152057-152079 AGAGAAAAATTAAGTGTGGAAGG - Intergenic
1185850057 X:3476877-3476899 ATGGGTAAATTGCATGTCGAGGG + Intergenic
1186069023 X:5797433-5797455 ATGGGTAAATTGAGTGTCAGAGG - Intergenic
1186071923 X:5830529-5830551 ATAGATAGATAGAGAGTGGATGG - Intergenic
1186092537 X:6065207-6065229 ATGGGTAAATTGGGTGTCGCTGG - Intronic
1186150436 X:6669193-6669215 ATGGATAGATTGATGATGGATGG + Intergenic
1186321430 X:8430066-8430088 TTGAATACAGTGAGTGTGGAGGG + Intergenic
1186662553 X:11683690-11683712 ATGGGTAAATTGTGTGTTGTGGG - Intergenic
1186713288 X:12223541-12223563 ATGGGTAAATTGTGTGTTGCAGG - Intronic
1186789068 X:12979391-12979413 ATGCAAAGATTGAGTGTGTATGG + Intergenic
1187209323 X:17213593-17213615 AAGGATCACTTGAGTCTGGAAGG - Intergenic
1187654435 X:21454095-21454117 ATGTGTAAATTGAGGTTGGAAGG - Intronic
1188088278 X:25929780-25929802 AGTGATAAAATGAATGTGGAAGG - Intergenic
1190075631 X:47314980-47315002 TTGTATAAATTGTATGTGGAGGG - Intergenic
1190127538 X:47720124-47720146 ATGGATAAATTGAGAGTTGCTGG - Intergenic
1190413595 X:50160595-50160617 AAGGATCAATTGAGCCTGGAAGG + Intergenic
1190588420 X:51971445-51971467 AAAGATAAATTGACTGTAGATGG - Intergenic
1191663099 X:63670596-63670618 GTGGATTAAATGAGTGTGCAAGG + Intronic
1191962352 X:66717976-66717998 ATAGATAAATTGAGGATTGATGG + Intergenic
1192130117 X:68541900-68541922 ATGGAAAAGTGGGGTGTGGAGGG - Intergenic
1193264076 X:79447073-79447095 ATGGGTAAATTGTGTGTTGTGGG + Intergenic
1194374737 X:93118215-93118237 ATGGGTAAATTGTGTGTTGCTGG - Intergenic
1194425588 X:93733558-93733580 ATGGATAAATTACATGTGGTTGG + Intergenic
1194434279 X:93850367-93850389 ATGGGTAAATTGCGTGTTGTGGG - Intergenic
1195043750 X:101037548-101037570 ATGGGCAAATTGTGTGGGGATGG + Intronic
1195142160 X:101972588-101972610 ATGGGTAAATTGTGTGTTGCTGG + Intergenic
1195638314 X:107143907-107143929 ATGAAGAAATTGAGAGTGGCAGG - Intronic
1198106776 X:133469556-133469578 GAGGATAAACTGAGTGTTGAGGG + Intergenic
1198483596 X:137064081-137064103 CTGGAAAAATTGAGGGTGGCTGG + Intergenic
1199080440 X:143570678-143570700 ATGGTCAAATTGTGTGTGCAAGG + Intergenic
1200682761 Y:6232281-6232303 ATGGGTAAATTGTGTGTTGCTGG - Intergenic
1200781558 Y:7220873-7220895 ATGTATAAATTAATTATGGAGGG + Intergenic
1200908055 Y:8505779-8505801 ATGGATTAATAGCCTGTGGAAGG - Intergenic
1201155180 Y:11126233-11126255 ATGGATAAAATGTGTGTCAATGG + Intergenic
1201491776 Y:14549603-14549625 ATGAATAAATTGTGTGGAGATGG - Intronic