ID: 1096599222

View in Genome Browser
Species Human (GRCh38)
Location 12:52717684-52717706
Sequence GAGGAGCTAGGCCGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096599222_1096599230 -1 Left 1096599222 12:52717684-52717706 CCTCGGCCTCGGCCTAGCTCCTC No data
Right 1096599230 12:52717706-52717728 CTGGGCAATCTCCTCATACGGGG No data
1096599222_1096599234 28 Left 1096599222 12:52717684-52717706 CCTCGGCCTCGGCCTAGCTCCTC No data
Right 1096599234 12:52717735-52717757 CCTTGGCAACGATACTGTCCAGG No data
1096599222_1096599229 -2 Left 1096599222 12:52717684-52717706 CCTCGGCCTCGGCCTAGCTCCTC No data
Right 1096599229 12:52717705-52717727 TCTGGGCAATCTCCTCATACGGG No data
1096599222_1096599228 -3 Left 1096599222 12:52717684-52717706 CCTCGGCCTCGGCCTAGCTCCTC No data
Right 1096599228 12:52717704-52717726 CTCTGGGCAATCTCCTCATACGG No data
1096599222_1096599232 11 Left 1096599222 12:52717684-52717706 CCTCGGCCTCGGCCTAGCTCCTC No data
Right 1096599232 12:52717718-52717740 CTCATACGGGGTGCAGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096599222 Original CRISPR GAGGAGCTAGGCCGAGGCCG AGG (reversed) Intergenic
No off target data available for this crispr