ID: 1096599482

View in Genome Browser
Species Human (GRCh38)
Location 12:52719130-52719152
Sequence ATGCAGGCCTTGGGCTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096599482_1096599487 0 Left 1096599482 12:52719130-52719152 CCAGTTTAGCCCAAGGCCTGCAT No data
Right 1096599487 12:52719153-52719175 CTTTCCAATGTATGGCCTTCTGG No data
1096599482_1096599488 1 Left 1096599482 12:52719130-52719152 CCAGTTTAGCCCAAGGCCTGCAT No data
Right 1096599488 12:52719154-52719176 TTTCCAATGTATGGCCTTCTGGG No data
1096599482_1096599485 -8 Left 1096599482 12:52719130-52719152 CCAGTTTAGCCCAAGGCCTGCAT No data
Right 1096599485 12:52719145-52719167 GCCTGCATCTTTCCAATGTATGG No data
1096599482_1096599490 7 Left 1096599482 12:52719130-52719152 CCAGTTTAGCCCAAGGCCTGCAT No data
Right 1096599490 12:52719160-52719182 ATGTATGGCCTTCTGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096599482 Original CRISPR ATGCAGGCCTTGGGCTAAAC TGG (reversed) Intergenic
No off target data available for this crispr