ID: 1096599751

View in Genome Browser
Species Human (GRCh38)
Location 12:52721200-52721222
Sequence CCTTAAGTTTGGGCAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096599751_1096599759 4 Left 1096599751 12:52721200-52721222 CCTTTACTTGCCCAAACTTAAGG No data
Right 1096599759 12:52721227-52721249 TCTCCTGGAGGGGCTGAAGAAGG No data
1096599751_1096599758 -6 Left 1096599751 12:52721200-52721222 CCTTTACTTGCCCAAACTTAAGG No data
Right 1096599758 12:52721217-52721239 TTAAGGTCAGTCTCCTGGAGGGG No data
1096599751_1096599761 10 Left 1096599751 12:52721200-52721222 CCTTTACTTGCCCAAACTTAAGG No data
Right 1096599761 12:52721233-52721255 GGAGGGGCTGAAGAAGGCTCTGG No data
1096599751_1096599762 28 Left 1096599751 12:52721200-52721222 CCTTTACTTGCCCAAACTTAAGG No data
Right 1096599762 12:52721251-52721273 TCTGGTTGACAGTCACTTCCTGG No data
1096599751_1096599757 -7 Left 1096599751 12:52721200-52721222 CCTTTACTTGCCCAAACTTAAGG No data
Right 1096599757 12:52721216-52721238 CTTAAGGTCAGTCTCCTGGAGGG No data
1096599751_1096599756 -8 Left 1096599751 12:52721200-52721222 CCTTTACTTGCCCAAACTTAAGG No data
Right 1096599756 12:52721215-52721237 ACTTAAGGTCAGTCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096599751 Original CRISPR CCTTAAGTTTGGGCAAGTAA AGG (reversed) Intergenic
No off target data available for this crispr