ID: 1096601014

View in Genome Browser
Species Human (GRCh38)
Location 12:52729525-52729547
Sequence TGAGGTCCACGCCCAGTACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096601014_1096601020 19 Left 1096601014 12:52729525-52729547 CCTCGTACTGGGCGTGGACCTCA No data
Right 1096601020 12:52729567-52729589 CCAGGTGCCAATTGTTGTCCAGG No data
1096601014_1096601021 20 Left 1096601014 12:52729525-52729547 CCTCGTACTGGGCGTGGACCTCA No data
Right 1096601021 12:52729568-52729590 CAGGTGCCAATTGTTGTCCAGGG No data
1096601014_1096601016 -5 Left 1096601014 12:52729525-52729547 CCTCGTACTGGGCGTGGACCTCA No data
Right 1096601016 12:52729543-52729565 CCTCAGCAATGATACTCTCCAGG No data
1096601014_1096601022 25 Left 1096601014 12:52729525-52729547 CCTCGTACTGGGCGTGGACCTCA No data
Right 1096601022 12:52729573-52729595 GCCAATTGTTGTCCAGGGAGAGG No data
1096601014_1096601017 1 Left 1096601014 12:52729525-52729547 CCTCGTACTGGGCGTGGACCTCA No data
Right 1096601017 12:52729549-52729571 CAATGATACTCTCCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096601014 Original CRISPR TGAGGTCCACGCCCAGTACG AGG (reversed) Intergenic
No off target data available for this crispr