ID: 1096601769

View in Genome Browser
Species Human (GRCh38)
Location 12:52734696-52734718
Sequence CAGGGCCCTATGGGAACAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096601758_1096601769 24 Left 1096601758 12:52734649-52734671 CCACTCTTCTGCCTCTGCCACAC No data
Right 1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG No data
1096601757_1096601769 25 Left 1096601757 12:52734648-52734670 CCCACTCTTCTGCCTCTGCCACA No data
Right 1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG No data
1096601760_1096601769 7 Left 1096601760 12:52734666-52734688 CCACACTAATGCAGTCAGCTACC No data
Right 1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG No data
1096601756_1096601769 26 Left 1096601756 12:52734647-52734669 CCCCACTCTTCTGCCTCTGCCAC No data
Right 1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG No data
1096601759_1096601769 13 Left 1096601759 12:52734660-52734682 CCTCTGCCACACTAATGCAGTCA No data
Right 1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096601769 Original CRISPR CAGGGCCCTATGGGAACAAC CGG Intergenic
No off target data available for this crispr