ID: 1096603244

View in Genome Browser
Species Human (GRCh38)
Location 12:52745618-52745640
Sequence AGTTACTGCATGGGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096603238_1096603244 -1 Left 1096603238 12:52745596-52745618 CCTCTGCCATTACCTTGGCCTCA No data
Right 1096603244 12:52745618-52745640 AGTTACTGCATGGGCAAAACTGG No data
1096603239_1096603244 -7 Left 1096603239 12:52745602-52745624 CCATTACCTTGGCCTCAGTTACT No data
Right 1096603244 12:52745618-52745640 AGTTACTGCATGGGCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096603244 Original CRISPR AGTTACTGCATGGGCAAAAC TGG Intergenic
No off target data available for this crispr