ID: 1096603399

View in Genome Browser
Species Human (GRCh38)
Location 12:52746721-52746743
Sequence GAGCTCTGCCAACTTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096603390_1096603399 11 Left 1096603390 12:52746687-52746709 CCTGGTCCTCCCTGGCCTGCTGC No data
Right 1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG No data
1096603395_1096603399 1 Left 1096603395 12:52746697-52746719 CCTGGCCTGCTGCAGGGCATCTC No data
Right 1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG No data
1096603396_1096603399 -4 Left 1096603396 12:52746702-52746724 CCTGCTGCAGGGCATCTCTGAGC No data
Right 1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG No data
1096603393_1096603399 5 Left 1096603393 12:52746693-52746715 CCTCCCTGGCCTGCTGCAGGGCA No data
Right 1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG No data
1096603394_1096603399 2 Left 1096603394 12:52746696-52746718 CCCTGGCCTGCTGCAGGGCATCT No data
Right 1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096603399 Original CRISPR GAGCTCTGCCAACTTGGCCT GGG Intergenic
No off target data available for this crispr