ID: 1096604003

View in Genome Browser
Species Human (GRCh38)
Location 12:52752128-52752150
Sequence TTGGAAGCTCAGCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096603993_1096604003 25 Left 1096603993 12:52752080-52752102 CCAAGGTTATATGCACAGATGTG No data
Right 1096604003 12:52752128-52752150 TTGGAAGCTCAGCTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096604003 Original CRISPR TTGGAAGCTCAGCTGGGGCA GGG Intergenic
No off target data available for this crispr