ID: 1096606694

View in Genome Browser
Species Human (GRCh38)
Location 12:52771804-52771826
Sequence GAGCTTATGCTGCTTCTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096606690_1096606694 26 Left 1096606690 12:52771755-52771777 CCACATGTGACACCATGAAAGGA 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG 0: 1
1: 0
2: 1
3: 18
4: 177
1096606688_1096606694 27 Left 1096606688 12:52771754-52771776 CCCACATGTGACACCATGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG 0: 1
1: 0
2: 1
3: 18
4: 177
1096606692_1096606694 14 Left 1096606692 12:52771767-52771789 CCATGAAAGGATGGAGAGAGCAT 0: 1
1: 0
2: 3
3: 31
4: 239
Right 1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG 0: 1
1: 0
2: 1
3: 18
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096606694 Original CRISPR GAGCTTATGCTGCTTCTCTC CGG Intronic
902846675 1:19116252-19116274 GAGGTTAAGCAGCTTCTCTAAGG + Intronic
903469331 1:23574843-23574865 GAGCTTGTGCTCCTTCTCAAGGG - Intergenic
903646952 1:24901734-24901756 GGGCCAATGCTGCCTCTCTCTGG + Exonic
910213092 1:84813968-84813990 GATGATCTGCTGCTTCTCTCAGG - Exonic
910455937 1:87397356-87397378 ACGCTTATTCTGGTTCTCTCTGG - Intergenic
911025865 1:93435047-93435069 GAACTTATGGTGCTTTTTTCAGG - Intergenic
914244026 1:145872690-145872712 GAGCTTCCGCAGCTTCTCTGTGG + Exonic
915612642 1:157006865-157006887 GAGCTCATGCTGCTGTTCTCAGG - Intronic
918127635 1:181598250-181598272 GAGCTTTTGCTCCTGCCCTCAGG + Intronic
918414664 1:184294224-184294246 CAGCTTATGCTCATTTTCTCTGG + Intergenic
920597019 1:207282220-207282242 GACCATATCCTGCTTTTCTCAGG + Intergenic
922204197 1:223432386-223432408 GAGCTTTAGCAGCCTCTCTCTGG + Intergenic
922913719 1:229238964-229238986 GAGTTTCTGATGCTTCTCCCAGG + Intergenic
1063898401 10:10706154-10706176 GAGTATATGATGCTTCTTTCAGG + Intergenic
1065201457 10:23316912-23316934 GAACTTATGGTGCTTTTTTCAGG - Exonic
1065530480 10:26665024-26665046 CAGCTCATGCTGCTTCTTACTGG + Intergenic
1066166694 10:32796162-32796184 GAGTTTTTGTTGCTTCTCTGTGG + Intronic
1066267315 10:33788814-33788836 GAGCTTATGCTTATTTTTTCTGG - Intergenic
1067172855 10:43922227-43922249 CTGCCGATGCTGCTTCTCTCTGG - Intergenic
1070130366 10:73651657-73651679 GAGCTTTGGCTCCTTATCTCAGG - Intronic
1070498885 10:77051747-77051769 GAGGTTATGCTCCTTGGCTCAGG - Intronic
1073423637 10:103443161-103443183 CAGCTTCTCCTGCTCCTCTCTGG - Exonic
1077731546 11:4736388-4736410 GACCTTATGCCGCTCCTCTGGGG + Intronic
1078920763 11:15828083-15828105 GAGATCATCCTGCTTCTCTGTGG - Intergenic
1080255707 11:30288470-30288492 GAGGTGATGCTGCTTGTCTGTGG - Intergenic
1081573460 11:44305501-44305523 CAGCTGTTGCTGCTTCTGTCGGG + Intronic
1084558771 11:69890915-69890937 GAGCTAGAGCTGCTTCTCGCTGG - Intergenic
1084586176 11:70064099-70064121 GAGTTTGTCCTGCTTCCCTCGGG + Intergenic
1084824864 11:71722368-71722390 GAGCTTTTGCTTCTTATCACAGG - Intergenic
1084863271 11:72036356-72036378 GAGGTTATGTTGCTTGTCTAAGG - Intronic
1086508301 11:87528647-87528669 GAACTTATGGTGCTTTTTTCAGG - Intergenic
1086575758 11:88337620-88337642 GCCCTCCTGCTGCTTCTCTCCGG - Exonic
1089832997 11:121345586-121345608 GAGCTTATGCTACCTATCCCTGG - Intergenic
1091073891 11:132595824-132595846 GTGTTTATGTTGCTTATCTCTGG + Intronic
1091397799 12:164354-164376 GAGATCACGCTGCTGCTCTCAGG - Intronic
1092388860 12:8057436-8057458 GTGCTTATGCTGCTCTTTTCTGG - Intergenic
1092418238 12:8308516-8308538 GAGCTTTTGCTTCTTATCACAGG + Intergenic
1092971452 12:13699634-13699656 GAGATAATGCTACTTCACTCCGG - Intronic
1093042765 12:14402935-14402957 GAGCTTTTACTGCTTTGCTCAGG + Intronic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1097333931 12:58361286-58361308 GAGCTAAGGCTCCTTCTCCCTGG - Intergenic
1098269836 12:68759154-68759176 TAGCTTATGGTGCTGCTATCTGG + Exonic
1098826460 12:75303860-75303882 GGTCTTATGCTGCATCACTCTGG - Intronic
1104879372 12:132059506-132059528 GAGCAAATGCAGATTCTCTCTGG + Intronic
1105815761 13:24034805-24034827 GAGCTTTTGCTTCTGCTCTCTGG - Intronic
1106765124 13:32906047-32906069 CAGCTGCTGCTGTTTCTCTCTGG + Intergenic
1108779055 13:53805535-53805557 GAACATATGCTACTTCTCTAGGG + Intergenic
1112090357 13:96076867-96076889 TGGCATATGCTGTTTCTCTCTGG - Intergenic
1112232918 13:97607418-97607440 GAGCTGATGCTGTTTCTGTCTGG - Intergenic
1114824142 14:26056532-26056554 GAGATTATGCTTATTCTCTGTGG + Intergenic
1114980501 14:28158106-28158128 GAACTTATGGTGCTTTTCTTAGG - Intergenic
1115851119 14:37591539-37591561 CAGCTTATGCTGCTGCTCCGAGG + Exonic
1117061751 14:51971033-51971055 GAACTACTGCTGTTTCTCTCTGG + Intronic
1119036184 14:71231833-71231855 GAACTTATGGTGCTTTTCCCTGG + Intergenic
1124158673 15:27250196-27250218 GAGCTGATGGTGCTCCTCTAGGG - Intronic
1124439072 15:29674208-29674230 GAGCGTTTGCTGCTTCTGGCTGG - Intergenic
1126066512 15:44830099-44830121 CAGCTTATACTGCCTCTCTGCGG + Intergenic
1126093369 15:45070770-45070792 CAGCTTATACTGCCTCTCTGCGG - Intronic
1129496784 15:75990427-75990449 AAGCTTGTTCTCCTTCTCTCAGG + Intronic
1129569323 15:76662431-76662453 GAGCTTGTTTTGCTTATCTCAGG - Intronic
1131726161 15:95227567-95227589 GAGAGGATGCTGCTTCTCTTTGG - Intergenic
1132193760 15:99893818-99893840 GAGCTAATGCCTCTTCTATCAGG + Intergenic
1134006363 16:10821139-10821161 AAGCTGATGCTGCTGCTCCCTGG + Intergenic
1134225002 16:12382831-12382853 GGCCTTCTCCTGCTTCTCTCTGG + Intronic
1136750591 16:32632360-32632382 CAGGATATGCTGCTTCTCTTAGG + Intergenic
1137895048 16:52203121-52203143 GGGCTTATGCTACTTGTCTAAGG + Intergenic
1138407043 16:56804418-56804440 GACATTATGCTGATTGTCTCTGG + Intronic
1142123827 16:88400422-88400444 GAGCTCCTGCTGCTGCTCCCAGG + Intergenic
1142261979 16:89047308-89047330 GAGCTTCTGCTTCTCCTCTGTGG - Intergenic
1203052721 16_KI270728v1_random:891566-891588 CAGGATATGCTGCTTCTCTTAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1152933784 17:83124353-83124375 GAGCTTATGCTGCTGGGCTGGGG + Intergenic
1155625657 18:27831714-27831736 GAGTTCATGCTGCATCTCTGTGG + Intergenic
1156112877 18:33748553-33748575 GAACTTATGCTGCTTTCCTCGGG - Exonic
1156261420 18:35447775-35447797 GATGTTCTGCTGCTTCTCTCAGG - Intronic
1157210872 18:45740867-45740889 GTGCTGATGCTGTTGCTCTCAGG + Intronic
1161234705 19:3192137-3192159 GAGATTGTGCTGCTGCACTCCGG + Intronic
1164510002 19:28889184-28889206 GGGCTTCTGCTGCTTCTCCTGGG - Intergenic
925104615 2:1280538-1280560 GAGCTTCTCCAGCTCCTCTCAGG + Intronic
925366407 2:3314968-3314990 CATCTTCTGCTGCTGCTCTCCGG + Intronic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
927339424 2:21965237-21965259 GATTTAATGCTGCTTCTCTCAGG + Intergenic
927457040 2:23261818-23261840 GAGCTTGTGCTGGTTCCCTGGGG + Intergenic
929889534 2:45907648-45907670 GGGCTCATGCTCCTTCTCCCTGG - Intronic
930795061 2:55380662-55380684 GAGATCATGCTGCTGCACTCTGG - Intronic
932983306 2:76697247-76697269 GGCCTTATCATGCTTCTCTCTGG - Intergenic
937767925 2:125683247-125683269 GAGTTTACTGTGCTTCTCTCAGG - Intergenic
937884698 2:126891808-126891830 GAGCTGATGCTGGCTCTCGCAGG - Intergenic
940721980 2:157292470-157292492 GAGCAGATGCTGCTTCCCTTAGG + Intronic
940956952 2:159738733-159738755 GAACTTATGGTGCTTATCCCAGG - Intronic
943960220 2:194254489-194254511 GAACTTATGCTGCTTTTTCCAGG + Intergenic
948420113 2:237853286-237853308 CTGCTTATTCTGCTTCTCACTGG - Intergenic
949073073 2:242038523-242038545 GAGCTCATTCTTCTCCTCTCAGG - Intergenic
1168921125 20:1537199-1537221 TAGTTTGTGCTGTTTCTCTCAGG + Exonic
1170219307 20:13925270-13925292 GAGTTTCTGTTGCTTCTGTCAGG + Intronic
1171187955 20:23136932-23136954 CAGCTGCTGCTGCTTCTCACTGG - Intergenic
1171241187 20:23568392-23568414 GCGCTGCTGCTGCTTCTCTTAGG - Exonic
1174915738 20:54651877-54651899 TAGCTGATCCTACTTCTCTCAGG + Intergenic
1175816524 20:61885948-61885970 GAGCTTCTCCAGCTCCTCTCAGG - Intronic
1176948458 21:15013597-15013619 GACCTTATGCTGCTTATTTCTGG - Intronic
1179072877 21:38089415-38089437 GCCCTTCTGCTGCATCTCTCTGG - Intronic
1181244076 22:21493067-21493089 GAGCTGATTCTGCTGCCCTCTGG - Intergenic
1183915832 22:41118032-41118054 TGGCTAATGCTGGTTCTCTCTGG + Intronic
1184641960 22:45877606-45877628 GAGCTTCTGCTGCTTTTCCCCGG + Intergenic
1185023450 22:48394082-48394104 GGTCTTCTGCGGCTTCTCTCTGG + Intergenic
950402048 3:12776439-12776461 GAATTGATGCTGCTTCTGTCAGG - Intergenic
953799498 3:46011467-46011489 CAGCTTATGCTGTCTCCCTCAGG - Intergenic
954872564 3:53778817-53778839 GAGCCTATGTGGCTTCTCCCAGG - Intronic
954874139 3:53790068-53790090 GGCCTGATGCAGCTTCTCTCTGG - Intronic
957417892 3:79929605-79929627 GAGCTTATGGTGCTTTTTCCAGG + Intergenic
960198020 3:114794620-114794642 GAGCTTAAGCTACTTCTCTATGG + Intronic
960628188 3:119701971-119701993 GAGATTATCCTGGTTATCTCAGG + Intergenic
960971827 3:123145398-123145420 GTGCTGCTGCTGCTTTTCTCAGG + Intronic
961801802 3:129456586-129456608 GAGATTATGCCACTGCTCTCTGG + Intronic
961895927 3:130167726-130167748 GAGCTTTTGCTTCTTATCACAGG + Intergenic
962254437 3:133860760-133860782 GAGCTCATCCAGCTGCTCTCAGG - Intronic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
962979608 3:140476000-140476022 GAGCTCCTGCTGCTTCCATCAGG - Intronic
964317526 3:155459913-155459935 GTGCTAATGCTGCTGATCTCAGG - Intronic
967845103 3:194036669-194036691 GAACTTAGGCAGGTTCTCTCAGG - Intergenic
968782317 4:2592561-2592583 GCGGTTATTCTTCTTCTCTCAGG - Intronic
968874325 4:3257377-3257399 GAGCTGCTGCTGCTTGTCGCAGG - Intronic
969746837 4:9079224-9079246 GAGCTTTTGCTTCTTATCGCAGG - Intergenic
971576674 4:28283430-28283452 CTGCTTTTGCTGCTTCTCACAGG - Intergenic
971714096 4:30153465-30153487 GAACTCATGGTGCTTTTCTCTGG - Intergenic
973262964 4:48183100-48183122 AAGCTCATGCTCCTTCTCTGAGG - Intronic
973309569 4:48694142-48694164 GAGATTAAGCTGCATATCTCGGG + Intronic
977556538 4:98492454-98492476 TTGCTTATGCTGGTTCTCTTTGG + Intronic
979002810 4:115247215-115247237 CAGCTTAGCCTGCTTCTCTAGGG + Intergenic
981745574 4:148049361-148049383 GAGTATAAGCTGCTTCTCTGAGG + Intronic
982264214 4:153523420-153523442 TGGCTTATTATGCTTCTCTCTGG - Intronic
982957708 4:161792506-161792528 GAACTTATGGTGCTTTTCCCTGG + Intronic
984404230 4:179306631-179306653 GAGCCGATGCTGCTTCTCTTAGG + Intergenic
986945951 5:13019888-13019910 GAGCTGATGCTGATTTTCTAAGG - Intergenic
987882547 5:23768024-23768046 GAGATTGTGCTGCTGCACTCTGG - Intergenic
989421225 5:41241267-41241289 GAGCTCATGCTACAGCTCTCTGG + Intronic
989691407 5:44149301-44149323 AAGCTTATTTTGCTTCTCCCCGG - Intergenic
989730459 5:44641795-44641817 GAATTTATGGTGCTTTTCTCAGG - Intergenic
992327712 5:75678812-75678834 TAGCTTTTGCTGCTTATCGCTGG + Intronic
992662396 5:78974558-78974580 GAGCATAAGCTGTTGCTCTCTGG - Intronic
992719048 5:79541500-79541522 AAGCTTATGCTACTTCTAACTGG - Intergenic
994328207 5:98474345-98474367 CAGCTTCTGCTGGTTCTCTAGGG - Intergenic
994891315 5:105639808-105639830 GAGCTTATGGTGCTTTTTCCAGG + Intergenic
995365659 5:111357193-111357215 GAGCTTATGTTACTTCACTCTGG + Intronic
997819612 5:137053152-137053174 GAGGTCATGCTTCTTGTCTCAGG - Intronic
1000296931 5:159920296-159920318 GAGATGATGTGGCTTCTCTCTGG + Intronic
1002887907 6:1312339-1312361 ATGCGCATGCTGCTTCTCTCCGG + Intergenic
1003124017 6:3340896-3340918 AAGCTTATGCTCCTTCTTTCAGG + Intronic
1004132020 6:12929468-12929490 GAGCTTATAGTTCCTCTCTCTGG - Intronic
1008495336 6:52127269-52127291 AATCTTATGCGACTTCTCTCTGG - Intergenic
1013510311 6:110838831-110838853 GAGGTTTTGCTGTTTCACTCAGG - Intronic
1017708095 6:157143069-157143091 TAGCTTCTGCTTCCTCTCTCTGG + Intronic
1018229740 6:161663983-161664005 CCGCTAATGCAGCTTCTCTCTGG + Intronic
1018459610 6:163985357-163985379 GGGCATATACTGCTTTTCTCTGG + Intergenic
1018684151 6:166290230-166290252 GAGCTAATGCAGATTCTCTCAGG - Intergenic
1020326614 7:6979337-6979359 GAGCTTTTGCTTCTTATCACAGG + Intergenic
1021436373 7:20621454-20621476 GTGCCTATGCTGCTGCTCTTGGG + Intronic
1024773527 7:52754851-52754873 AAGCTTATGCTGATTTGCTCTGG - Intergenic
1029503973 7:100950963-100950985 GAGCTTAGCCTGTTTCTCTTTGG + Intronic
1034101801 7:148457194-148457216 GAACTTATGGTGCTTTTTTCAGG - Intergenic
1036370006 8:8154590-8154612 GAGCTTTTGCTTCTTATCACAGG - Intergenic
1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG + Intronic
1036880886 8:12511040-12511062 GAGCTTTTGCTTCTTATCACAGG + Intergenic
1042439665 8:68810899-68810921 GAACTTATGATGCTTCTCCTAGG - Intronic
1042484567 8:69336381-69336403 GAGCTTATTCTTCTCCTCTCAGG - Intergenic
1043291053 8:78601791-78601813 CAGATTTTGCTGCTTCTCCCTGG - Exonic
1043919142 8:85961336-85961358 GAGTTTTTGCTACTTCTTTCAGG + Intergenic
1044738219 8:95300730-95300752 GAGCTTAGGCTGCTTGCCTAAGG - Intergenic
1045327090 8:101125645-101125667 CAGCTGATGCTGCTTATTTCGGG + Intergenic
1045873375 8:106950403-106950425 GAACTTATGTTGCTTTTTTCAGG + Intergenic
1049737976 8:144220149-144220171 GAGCTAATGCTGCTGGTCTGGGG - Intronic
1049980632 9:901061-901083 GAGATCATGCTGCTGCACTCTGG - Intronic
1052691451 9:31821033-31821055 GAACTTATGGTGCTTTTTTCAGG + Intergenic
1054971140 9:71088533-71088555 ATACATATGCTGCTTCTCTCTGG + Intronic
1055742055 9:79400734-79400756 GAGCATAGGCTGTGTCTCTCTGG - Intergenic
1055928362 9:81533698-81533720 GAGGTTTTGCTGCATCTGTCAGG - Intergenic
1056820918 9:89841585-89841607 GAGCTTGTGCTGGTTCCCACTGG - Intergenic
1056901143 9:90600478-90600500 GAGCCTTTGCTGATTCTCCCTGG + Intergenic
1057464350 9:95298628-95298650 GAACTCATGCTACTTCTCCCTGG - Intronic
1057606936 9:96505417-96505439 TAGCTTATGCTGTTTCTTTTGGG - Intronic
1057731205 9:97610180-97610202 GTGCTTATACTGTTTCTCTGTGG - Intronic
1058263907 9:102873728-102873750 GAGACTTTGCTGCTTCTCTCAGG - Intergenic
1060037155 9:120265297-120265319 GATCAAATGCTGCTTCTTTCAGG + Intergenic
1060816280 9:126637048-126637070 GAGCTTATGCTGGTGGCCTCTGG - Intronic
1061296052 9:129677434-129677456 GAGCCTAGGCTGCTTCTAGCAGG - Intronic
1061667948 9:132171143-132171165 GAGGTAGTGCTGCCTCTCTCTGG - Intronic
1062006571 9:134241301-134241323 GAGATCATGCTACTTCACTCTGG + Intergenic
1185460876 X:332341-332363 GAGCTCATGCTGCTGCTCCTGGG + Intergenic
1185664494 X:1754696-1754718 GTGCTGCTGCTGCTTCTCCCAGG + Intergenic
1187410669 X:19048144-19048166 GAACTCATCCTGGTTCTCTCAGG + Intronic
1189793021 X:44621257-44621279 GAGTTTATGGGGCTTCTCTGGGG + Intergenic
1197033369 X:121845971-121845993 AAGCTTCTGCTGCTGCTGTCTGG - Intergenic
1197694157 X:129533117-129533139 GAGCTTATGCTGCTTATGTCTGG + Intergenic
1198527706 X:137518776-137518798 TCGCTTATGCTGTTTCTCCCTGG - Intergenic
1198739750 X:139829141-139829163 GACATTCTGCTGCTTCTTTCAGG - Intronic
1198855896 X:141015850-141015872 TAGCTAATCCTGCTTCTTTCTGG + Intergenic
1198906797 X:141571517-141571539 TAGCTAATCCTGCTTCTTTCTGG - Intergenic