ID: 1096611305

View in Genome Browser
Species Human (GRCh38)
Location 12:52803793-52803815
Sequence GGGGGCTGTGCCCCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096611305 Original CRISPR GGGGGCTGTGCCCCCTTTGT GGG (reversed) Intergenic
900550240 1:3250927-3250949 GGGGGCTGTGTCCCCCATCTCGG + Intronic
900800783 1:4735789-4735811 AGGGGCTGTGCCCCATTTTCAGG - Intronic
901300891 1:8199533-8199555 GTGGGATGTTCCCCCTTTGCAGG + Intergenic
901817499 1:11803245-11803267 GGGGGCAGTGTCACCTTTTTTGG - Exonic
901850240 1:12010504-12010526 GGGGGCTATGCCCTCTTCATGGG - Intronic
902368811 1:15993115-15993137 GGGGTCTGTGCCTCCTGTGGTGG - Intergenic
902617998 1:17634468-17634490 GGGGGCTGTGACCCCGCTGGGGG - Intronic
905182432 1:36175511-36175533 AGGGGCTATGCCACCTTGGTTGG - Intronic
905455127 1:38083392-38083414 GTGGGTGGTGCCCCCTGTGTTGG + Intergenic
905502499 1:38450812-38450834 TGGGGCTGTGCTCCCTCTGAAGG + Intergenic
905914091 1:41673127-41673149 GGGAGCTGAGCCCCATTTGGTGG - Intronic
906659944 1:47574941-47574963 GGGGGCCGTGCGTCCTTTGGTGG + Intergenic
909629721 1:77759310-77759332 GGGGGCTCTGCTCCCTTCCTCGG - Intronic
910425986 1:87120494-87120516 GGGGGTTGTGTCTCCATTGTAGG + Intronic
911498870 1:98661807-98661829 GGGGGCGGCGCCCCCTTTCCGGG + Exonic
912209456 1:107542676-107542698 GGGTGCTTTGCCCCCTTTTCAGG - Intergenic
912299692 1:108502301-108502323 GGGGGCTGTGGCCCAATTGCAGG - Intergenic
914824810 1:151132917-151132939 GGGGGCTCGGCCCCCTTTCTGGG + Exonic
915463100 1:156081413-156081435 GGGGGCGGGTCCCCCTTTGTGGG + Intronic
916500769 1:165384869-165384891 TGGGAATATGCCCCCTTTGTGGG - Intergenic
919749713 1:201029672-201029694 GGGAGCTGTGCTCACTTTCTTGG - Intergenic
920693411 1:208163961-208163983 GGGGGAAGCGGCCCCTTTGTGGG - Intronic
922481584 1:225943089-225943111 GGGCACTCTGGCCCCTTTGTGGG + Intergenic
922481601 1:225943167-225943189 GGGCACTCTGGCCCCTTTGTGGG + Intergenic
1063388849 10:5635447-5635469 AGGGGCTGTGCCCCCTGTAATGG - Intergenic
1064216267 10:13403252-13403274 GGGGGCTCTGCCCCTGTTGAAGG - Intergenic
1065773533 10:29099512-29099534 GGTGGCTATGCCACCTTTATGGG - Intergenic
1066041070 10:31548461-31548483 GGGGCCTGTAGCCCCTTTTTTGG + Intergenic
1067726490 10:48774853-48774875 GGGGGCTATGTCTGCTTTGTGGG - Intronic
1067783098 10:49223247-49223269 GGGGGCTCTGCCCCTGTGGTAGG + Intergenic
1069745637 10:70713289-70713311 GGGTGCTGTGCTACCTCTGTGGG + Intronic
1075407514 10:122204410-122204432 GGGGACTGTGGCCCCTTGGTCGG + Intronic
1075655999 10:124161765-124161787 GGGGCCAGGGCCCCCTCTGTGGG + Intergenic
1077084600 11:742696-742718 GTGGGCAGTGCTCCCTTTGGTGG + Intergenic
1077256231 11:1584705-1584727 GGGGGCTGTGGCTCCTGTGGAGG - Exonic
1077256313 11:1584999-1585021 GGGGGCTGTGGCTCCTGTGGAGG - Exonic
1077258030 11:1597943-1597965 GGGGGCTGTGGCTCCTGTGGGGG - Exonic
1077258042 11:1597973-1597995 GGGGGCTGTGGCTCCTGTGGGGG - Exonic
1077259464 11:1608141-1608163 GGGGGCTGTGGCTCCTGTGGAGG - Exonic
1077261138 11:1621717-1621739 GGGGGCTGTGGCTCCTGTGGGGG - Exonic
1077261150 11:1621747-1621769 GGGGGCTGTGGCTCCTGTGGGGG - Exonic
1077261162 11:1621777-1621799 GGGGGCTGTGGCTCCTGTGGGGG - Exonic
1077261174 11:1621807-1621829 GGGGGCTGTGTCTCCTGTGGGGG - Exonic
1077262498 11:1630189-1630211 GGGGGCTGTGGCTCCTGTGGGGG + Exonic
1077262511 11:1630219-1630241 GGGGGCTGTGGCTCCTGTGGGGG + Exonic
1077262524 11:1630249-1630271 GGGGGCTGTGGCTCCTGTGGGGG + Exonic
1077986486 11:7356431-7356453 GGGGGCTTTGCCCCTTCTGCTGG + Intronic
1084439770 11:69166221-69166243 CGGGGCTGTGGCCCCGTTGGTGG - Intergenic
1084803926 11:71565861-71565883 GGGGGCTGTGGCTCCTGTGGGGG + Exonic
1084803949 11:71565921-71565943 GGGGGCTGTGGCTCCTGTGGGGG + Exonic
1090401319 11:126450060-126450082 TGGGGCAGTGACCCCTGTGTTGG + Intronic
1091781821 12:3218693-3218715 GGGGGCTGAGCCCGCTTGGCTGG + Intronic
1096611305 12:52803793-52803815 GGGGGCTGTGCCCCCTTTGTGGG - Intergenic
1097190677 12:57217999-57218021 GGGGCCTGGGCCCCCATTGCGGG - Intronic
1101995407 12:109521946-109521968 GGAGGCTGGGTCCCCGTTGTAGG + Intronic
1102396494 12:112590469-112590491 AGGGGCTGTGCTATCTTTGTGGG - Intronic
1103730375 12:123023222-123023244 GAGGGCTGTGCTCCCTGTGAGGG + Intronic
1104858035 12:131910953-131910975 AGGGGCTGTCACCCGTTTGTGGG - Intronic
1106193735 13:27476088-27476110 TCAGGCTGTGCCCCCTTTGCAGG + Intergenic
1112677767 13:101723233-101723255 GGGAGCTATGGCCTCTTTGTGGG + Intronic
1113159740 13:107366486-107366508 TTGGGCTGAGCCCCTTTTGTTGG - Intronic
1113174347 13:107545346-107545368 AGGGTCTGTGCTCCCTTTGAAGG - Intronic
1113502597 13:110788924-110788946 CGGGGCTGTGCTCCCTCTGAAGG + Intergenic
1114312037 14:21476740-21476762 GGGGGCGGGGCTCACTTTGTGGG - Exonic
1114984621 14:28210837-28210859 AGGGGCTGTAGCCCCTTTATGGG + Intergenic
1120182923 14:81364716-81364738 TCACGCTGTGCCCCCTTTGTTGG - Intronic
1121105675 14:91278021-91278043 AGGGGCTGTGCCCCTCTTCTGGG + Exonic
1121492801 14:94372096-94372118 GGTGGCTGTGCCCCCCTGGGGGG - Intergenic
1121864160 14:97346855-97346877 GAGGGCTGTGCTCCCTCTGGAGG - Intergenic
1122042135 14:98996337-98996359 GGGGGCTGAGCAGCCTTTGAAGG - Intergenic
1122458605 14:101877349-101877371 TGAGGCTGTGCTGCCTTTGTTGG + Intronic
1123071281 14:105643651-105643673 GGGGGCTGGGAGGCCTTTGTTGG + Intergenic
1123076238 14:105668691-105668713 GGGGGCTGGGAGGCCTTTGTTGG + Intergenic
1125577406 15:40764962-40764984 GGGGGTTGTGTACCCTTTGCTGG - Intronic
1127864380 15:63019909-63019931 GGGGGCTCTACCCCGTGTGTCGG - Intergenic
1129322970 15:74784764-74784786 GGTGGGTCTGCCCCCTTTGGGGG - Intronic
1130000419 15:80041736-80041758 GTGGACTGTGCCCTCTTTGGAGG - Intergenic
1133297848 16:4763852-4763874 AGGGGATGTGCCTCCTCTGTTGG + Intronic
1134134226 16:11668785-11668807 GGGGGCGGAGGCCGCTTTGTGGG + Intronic
1136024434 16:27460885-27460907 GGGGGCTGTGGCCCCTCCGCAGG - Exonic
1136084278 16:27873583-27873605 TGGGGCTGTGCCACCATTTTTGG - Intronic
1136485644 16:30570244-30570266 GGGGGCTGTGCTCCTGTGGTCGG + Exonic
1136618598 16:31413257-31413279 GGGGCCTGGGCCCCCTTTATGGG - Intronic
1137580799 16:49632412-49632434 TGGGGCCTTGCCCCCTGTGTGGG - Intronic
1138311023 16:56024214-56024236 GGGGGGTGTGCTGCCTTTGTGGG - Intergenic
1138449892 16:57087489-57087511 GAGGGCTGTGCACCCTTCTTGGG + Intergenic
1138572549 16:57884924-57884946 TGGGGCTGGGCCCCCTTTCTGGG + Intronic
1141492467 16:84383355-84383377 AGGCGCTGTGCCCATTTTGTTGG - Intronic
1141522739 16:84592114-84592136 GGGTGTTCTGCCCCCTTTGGAGG - Intronic
1142054212 16:87982537-87982559 AGGGACCGTGCCTCCTTTGTAGG + Intronic
1142428598 16:90013828-90013850 CGGGGCTGTGCTCCCATTTTAGG + Intronic
1142945363 17:3421945-3421967 TTGGGCTGTGCCCGCTTTCTCGG + Intergenic
1145944214 17:28760775-28760797 GGGGGCTTTGCCCACTGGGTGGG + Intronic
1146838029 17:36127811-36127833 GGGGGATGTGCCCTCCATGTGGG + Intergenic
1148984273 17:51608128-51608150 GGAGGCTGTGAACCCTTTGTGGG - Intergenic
1152092732 17:78256143-78256165 GGTGCCTGTGCTCCCTGTGTGGG - Intergenic
1152334909 17:79695244-79695266 GGAGGCTGTGCCACGTCTGTGGG + Intergenic
1157578189 18:48758011-48758033 GGGTGCTGAGCCCCCCTGGTAGG - Exonic
1161333166 19:3697821-3697843 TGCGGCTGTGCCCACTGTGTGGG - Intronic
1161515287 19:4693026-4693048 GGGGTCTCTGTCCCCTGTGTTGG + Intronic
1162745624 19:12796405-12796427 CGGGGCTGAGGCCCCTGTGTAGG - Intronic
1162780109 19:13002439-13002461 GGGGCCTGGGCCCCCTGAGTGGG + Intronic
1162931140 19:13958419-13958441 GGGGGATGTGGCCCCTCTCTAGG + Intronic
1164204431 19:23046067-23046089 GGGGACTGTGTCCCCTTAGTGGG + Intergenic
1164538520 19:29105297-29105319 GGGAGCTCTGGCCCCCTTGTAGG + Intergenic
1165269475 19:34692758-34692780 GTGGGCTGTGCCCCCCTTCCAGG + Intergenic
1165419340 19:35715370-35715392 GTGGGCTGAGGCCCCTTGGTTGG + Exonic
1165818612 19:38659828-38659850 GGGGAGTGTGCCCCCTTATTTGG + Intronic
1167138716 19:47634366-47634388 GTTGGCTGTGCCCACTTTGGTGG + Intronic
925920148 2:8632714-8632736 GGGGGCTGTGGCCCAGATGTTGG - Intergenic
933750441 2:85599592-85599614 CGGGGCGGTGGCCCCTTGGTAGG + Exonic
934657813 2:96125139-96125161 GGGGGCTGTGAAGCCTATGTAGG - Intronic
937226685 2:120374446-120374468 AGGGGATGTGACCCCTTTCTTGG + Intergenic
944604746 2:201342534-201342556 GGGGGCTGTGCCCCATGAATTGG - Intronic
945139327 2:206667189-206667211 GGGGTCTGTGCCGTCTTTGTGGG - Intronic
947739268 2:232477684-232477706 GTGAGCTGTGCCCTGTTTGTGGG + Intergenic
949005482 2:241644461-241644483 GGTGGCTGTGCCCCATTTCATGG + Intronic
1168918285 20:1509681-1509703 GGGGGCATTGCCCAGTTTGTGGG + Intergenic
1170594468 20:17794661-17794683 GGGGGCTGAGCCACCTTGTTTGG - Intergenic
1170608178 20:17889448-17889470 TGGGGCTGTGCTCCCTCTGGAGG + Intergenic
1175349960 20:58310252-58310274 GGGGGCTGTTTGCTCTTTGTGGG - Intronic
1175810213 20:61853697-61853719 GGGGGCTGTGCCAGCCCTGTGGG - Intronic
1176407905 21:6431413-6431435 GAGGGCTGTGCCCCAGGTGTGGG + Intergenic
1178919801 21:36731219-36731241 GGGGGACGTGTCCCTTTTGTTGG + Intronic
1178979007 21:37245305-37245327 GAGGGCGGGTCCCCCTTTGTAGG - Intronic
1179683396 21:43039744-43039766 GAGGGCTGTGCCCCAGGTGTGGG + Intergenic
1180051990 21:45335536-45335558 CGGGCCTGTGCCCCCTCTCTGGG + Intergenic
1180117820 21:45723700-45723722 GCGGGCTGTGCTCCCTTGCTGGG - Intronic
1181309763 22:21938267-21938289 GGTGGCGGCGCCCCCTTGGTGGG + Intronic
1181594000 22:23902716-23902738 GAGGGCTGTTCCCACTTTGTTGG + Intergenic
1181643399 22:24216774-24216796 GGGGGCTGTCCCCACACTGTAGG - Intergenic
1183227301 22:36559240-36559262 GGGATGTGTGCCCACTTTGTGGG + Intergenic
1183338642 22:37265849-37265871 GGGGGCTGAGCCAGCTTAGTGGG - Intergenic
1183344461 22:37299334-37299356 TGGGGCTGTGCCACCCTTGAGGG - Intronic
1183428284 22:37751168-37751190 CGGGGCTGTGCCCCCCTGGGCGG + Intronic
1183568936 22:38637665-38637687 GCTGGCTGTGCCACCTTTGCAGG + Intronic
1184694564 22:46132213-46132235 GGGGCCTGAGCCCTCTCTGTGGG - Intergenic
1185342995 22:50299892-50299914 AGGGGCTGTGCCACCTGGGTCGG - Intronic
949543168 3:5050137-5050159 AGGGACAGTGCCCACTTTGTGGG + Intergenic
951755226 3:26083748-26083770 AGAGGCTTTGCCTCCTTTGTAGG + Intergenic
953534919 3:43770069-43770091 GTGGGCCATGTCCCCTTTGTGGG - Intergenic
953692624 3:45132796-45132818 AGAGGCTTTGCCCCCTCTGTCGG - Intronic
954797021 3:53166765-53166787 GGGGGCTGGGCCACCCTGGTAGG + Intronic
955348111 3:58175735-58175757 GGGGGCTGCCCTCCCTTTCTAGG + Intergenic
957474348 3:80704826-80704848 GGGGCCTGTAGCCCCTTTTTTGG - Intergenic
960126655 3:114005938-114005960 GACTGCTGTGCCCCCTTTGTGGG - Exonic
961247951 3:125473130-125473152 GGGCGCTGTGCTCACTGTGTGGG - Intronic
967175692 3:186862112-186862134 GGGGATTGTGCAGCCTTTGTTGG + Intergenic
971972298 4:33635548-33635570 GGGGTTTGTGGCCCCTTTTTTGG + Intergenic
977912068 4:102548655-102548677 CAGGGCCGTGCCCCCTTTGAAGG + Intronic
985610405 5:884792-884814 TGGGGCTGTGACTCCTGTGTAGG - Intronic
985671844 5:1210811-1210833 GGGGGCTGTGCCTGCTCTGAGGG + Intronic
985881215 5:2640523-2640545 GGGGGCTGTGCCCTGGGTGTAGG + Intergenic
986932252 5:12840552-12840574 TGGGGCTGTGCTCCCTCTGAAGG + Intergenic
988150037 5:27365147-27365169 GGGGCCTGTAGCCCCTTTTTTGG + Intergenic
989933379 5:49986482-49986504 GGGGGCTTTGAAGCCTTTGTTGG + Intergenic
990487976 5:56277887-56277909 GGGAGCTGTGTCCCCTTCCTGGG - Intergenic
990977391 5:61571725-61571747 GTGGGCAGTGCAGCCTTTGTGGG - Intergenic
990996851 5:61740999-61741021 GGGGGCTCTGACACCTTTGCTGG - Intronic
994160187 5:96548654-96548676 TAGGGTTGTTCCCCCTTTGTAGG - Intronic
997709825 5:135994906-135994928 GGAGGCTGTGCCCCTATTCTAGG + Intergenic
999388745 5:151174606-151174628 TGGGACTCTGCCTCCTTTGTGGG + Intergenic
999937173 5:156500127-156500149 GGGGGCTGTATCCCCCTGGTTGG + Intronic
1001155396 5:169268557-169268579 GGGGGCTGTGTCTGCTCTGTGGG - Intronic
1001793655 5:174483400-174483422 GGGGGCTCTTCTCCCATTGTGGG - Intergenic
1001950545 5:175813680-175813702 ATGGTCTGTGCCCACTTTGTGGG - Intronic
1002213160 5:177610159-177610181 GCTGGCTGTTCCCCCTCTGTGGG - Exonic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006672877 6:35740605-35740627 GGGGGCTGTGCTCTATTTCTTGG - Intronic
1008305868 6:49899384-49899406 TGGGGCTGTGCTCCCTCTGAAGG - Intergenic
1010777672 6:79905906-79905928 CTGGGCTGTGCTCCCTTTGAAGG + Intergenic
1014828473 6:126073936-126073958 AGGGGCTTTACCCCCTTTGCTGG - Intergenic
1017818518 6:158032120-158032142 GCGGGCTGTGCTCCCTGTGGGGG + Intronic
1017818530 6:158032178-158032200 GCGGGCTGTGCTCCCTGTGGGGG + Intronic
1018004715 6:159611158-159611180 GGGGGCTGAGCCCTCATTCTTGG - Intergenic
1018370717 6:163165514-163165536 TGGGGCTTTGACCCCTTTATGGG - Intronic
1018696975 6:166397915-166397937 GAGGGCTGTGCCAGCTGTGTTGG + Intergenic
1019399265 7:842249-842271 GGAGGCTGTGGCCACATTGTGGG + Intronic
1019412183 7:911468-911490 GGGCGCTGGGGCCCCTGTGTGGG - Intronic
1020153378 7:5701390-5701412 GGAGGCAGTTCCCCCTTTCTAGG + Intronic
1021549135 7:21851237-21851259 AGGGGCTTTTCCCCCTTTGCTGG + Intronic
1022575782 7:31495736-31495758 AGGGGCTTTTCCCCCTTTGCTGG - Intergenic
1023478318 7:40605009-40605031 GGGGGCTGTGTGCCCTCTGCTGG + Intronic
1026233638 7:68507483-68507505 GTGGACTCTGCCTCCTTTGTGGG - Intergenic
1029463328 7:100709230-100709252 GCGGGTTGTGACCCATTTGTGGG + Intergenic
1031024522 7:116665540-116665562 GTGGGCTGAGCTCCCTGTGTTGG - Intergenic
1035023719 7:155813488-155813510 GGGCACTGTGCCCTCTTTCTAGG - Intergenic
1036944822 8:13085191-13085213 GGGTGTTGGGCCCCCTTTCTGGG + Exonic
1039912008 8:41833382-41833404 GGGGGTGGTGCCTCCTTTCTGGG + Intronic
1045055150 8:98362417-98362439 GGGGGCTGTGACCGCTCTGCTGG + Intergenic
1048899261 8:139022160-139022182 GGGGGCTGGTCCCCCTCTGCAGG + Intergenic
1059355033 9:113692165-113692187 GGGGTCTGTGGCTACTTTGTGGG - Intergenic
1060479298 9:124008702-124008724 GGGGCTGGTGGCCCCTTTGTTGG + Intronic
1060826665 9:126691814-126691836 GGGGGCTGGGCCCTCTGTGCTGG + Intronic
1061049082 9:128183490-128183512 AGGGGCAATGCCCCCTTTGCTGG - Intronic
1061445091 9:130633048-130633070 AGGGCCTGAGCCCCCTTTCTGGG + Intronic
1061509018 9:131049149-131049171 GGGGGCTGGCCGCCCTGTGTCGG + Intronic
1061931422 9:133834934-133834956 GGGGCTTCTGCTCCCTTTGTAGG - Intronic
1062097407 9:134710492-134710514 GGGGGAGGAGCCCCATTTGTTGG + Intronic
1062097455 9:134710617-134710639 GGGGGAGGGGCCCCATTTGTTGG + Intronic
1062097587 9:134710974-134710996 GGGGGAGGGGCCCCGTTTGTTGG + Intronic
1062385803 9:136311064-136311086 GTCTGCTGGGCCCCCTTTGTGGG + Intergenic
1062462859 9:136669125-136669147 GGGGTGTGTGCCCCTTGTGTGGG - Intronic
1062645693 9:137547067-137547089 GAGGGGAGAGCCCCCTTTGTTGG - Intronic
1186068421 X:5791194-5791216 CAGGGCTGTGCCCCCTCTGGAGG - Intergenic
1188895855 X:35667629-35667651 AGGGGCTCTTCCCCCTTTGCTGG + Intergenic
1189302954 X:39965999-39966021 GGGGTCTGTGCCCTTTCTGTGGG - Intergenic
1191826777 X:65374821-65374843 AGGGGCTTTTCCCCCTTTGCTGG - Intronic
1195942349 X:110176630-110176652 GGGAGCTGTGCCCACTTCATAGG - Exonic
1199016255 X:142819587-142819609 GGGGCCTGTGCCTCCTTGATGGG - Intergenic
1200251570 X:154556929-154556951 AGGGGCCGTGCTCCCTTTGAGGG + Intronic
1200266197 X:154647487-154647509 AGGGGCCGTGCTCCCTTTGAGGG - Intergenic
1200773791 Y:7151595-7151617 TGGGGCTGTGCTCCCTCTGGAGG + Intergenic