ID: 1096614612

View in Genome Browser
Species Human (GRCh38)
Location 12:52824729-52824751
Sequence GGGTGCCTTTGTGCAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096614599_1096614612 22 Left 1096614599 12:52824684-52824706 CCTCAGAACACCCTGTGCAGCTG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1096614608_1096614612 -6 Left 1096614608 12:52824712-52824734 CCCATGGCAGGCTCACAGGGTGC 0: 1
1: 0
2: 3
3: 20
4: 220
Right 1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1096614598_1096614612 30 Left 1096614598 12:52824676-52824698 CCTCTAGGCCTCAGAACACCCTG 0: 1
1: 0
2: 3
3: 16
4: 224
Right 1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1096614602_1096614612 12 Left 1096614602 12:52824694-52824716 CCCTGTGCAGCTGGCAGGCCCAT 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1096614609_1096614612 -7 Left 1096614609 12:52824713-52824735 CCATGGCAGGCTCACAGGGTGCC 0: 1
1: 0
2: 2
3: 31
4: 336
Right 1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1096614603_1096614612 11 Left 1096614603 12:52824695-52824717 CCTGTGCAGCTGGCAGGCCCATG 0: 1
1: 0
2: 4
3: 24
4: 333
Right 1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG 0: 1
1: 0
2: 0
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096614612 Original CRISPR GGGTGCCTTTGTGCAAATTG GGG Intronic
901637648 1:10677797-10677819 GGGGGCCTTTGTGGTATTTGGGG - Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902353056 1:15872873-15872895 GGCTGCCTTTGTGGATTTTGTGG + Exonic
903610622 1:24609103-24609125 GGGTTCCTATGTGCAAGTTGAGG + Exonic
905031753 1:34888888-34888910 GGCTGCATTTGTTCTAATTGGGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
907309914 1:53533405-53533427 GGGTACCTTTCTGCACACTGGGG - Intronic
909385574 1:75052211-75052233 ACGTGACTTTGAGCAAATTGTGG + Intergenic
909469736 1:76013694-76013716 GGGTGCCTGTCTGCTAGTTGGGG + Intergenic
911575749 1:99575619-99575641 GGGGGACTTTGGGAAAATTGGGG - Intergenic
912826602 1:112909848-112909870 GGCTGCCTAGGTTCAAATTGAGG - Intergenic
914959470 1:152193651-152193673 GGGTCCCTTAGTCCAAACTGGGG + Intergenic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
1062836419 10:639072-639094 GGGTCCCCTTGTGCCCATTGTGG - Intronic
1067808186 10:49407667-49407689 GGGTGGCTCTGTGCAACTTCAGG - Intergenic
1068783274 10:60944110-60944132 TGCTGCCTTTGTGCAAAGTTGGG - Exonic
1068921933 10:62493876-62493898 GGCTGCCTTTTAGGAAATTGAGG + Intronic
1069024282 10:63522308-63522330 TGTTGCCTTTGTTCAAATTATGG + Intronic
1070129344 10:73646267-73646289 GGGTGGCTTAGTGCAAACAGGGG + Exonic
1070787128 10:79168364-79168386 GGGTGCCTGTGTGCAGATGAAGG - Intronic
1071502717 10:86215006-86215028 GGCTCCCTTTCTCCAAATTGTGG - Intronic
1073514233 10:104062666-104062688 GGGTGCCTTGGTGCACAGTGTGG + Intronic
1078485526 11:11719613-11719635 GGGTGCATGTGTGCAAAGTAAGG + Intergenic
1095962415 12:47843973-47843995 AGGTGCTTTTCTGCAAACTGGGG + Exonic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096434156 12:51574314-51574336 GGGTGACTTGGTGCACATTCTGG + Intergenic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1098981344 12:76960011-76960033 GGGTTCCTTTGTACAAATGTGGG + Intergenic
1101722097 12:107359152-107359174 TGGTGCCTGTGCTCAAATTGAGG + Intronic
1102430604 12:112879920-112879942 GTGTGCCTATTTGTAAATTGGGG + Intronic
1102783985 12:115588900-115588922 GGGAGCCTTTGTGTAAAGTCTGG - Intergenic
1104323914 12:127777783-127777805 GCTTGCCTTTCTGCAAAATGTGG + Intergenic
1104552673 12:129771526-129771548 GGTTGCCTATTTGCAAACTGGGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1119967776 14:78936165-78936187 GGGTGTGTTTGTGTACATTGGGG - Intronic
1123149053 14:106164125-106164147 GGTTGCCTTTGTTCAATTTGTGG + Intergenic
1127779307 15:62297446-62297468 GGCTGCCTTTGTGCAGAAAGAGG - Intergenic
1128692358 15:69734677-69734699 GGGTGCCATTTTGCAACCTGGGG + Intergenic
1129526273 15:76217141-76217163 GGGTGCCTTCTTGAAATTTGTGG - Intronic
1134194750 16:12150773-12150795 GGGTTCATTTGTGCAGATTGGGG + Intronic
1134352238 16:13448425-13448447 GGGTGTCTTTGTGATGATTGGGG - Intergenic
1136681169 16:31963432-31963454 GGTTGCCTTTGTTCAATTTGTGG - Intergenic
1136781482 16:32904944-32904966 GGTTGCCTTTGTTCAATTTGTGG - Intergenic
1136888313 16:33948896-33948918 GGTTGCCTTTGTTCAATTTGTGG + Intergenic
1137840164 16:51633450-51633472 GGGTGCCTTGGTGCACAGTTTGG - Intergenic
1139705461 16:68737788-68737810 GGGTGCCCTGGTGCAAGTCGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1203084135 16_KI270728v1_random:1168926-1168948 GGTTGCCTTTGTTCAATTTGTGG - Intergenic
1144856525 17:18271486-18271508 GGGTGTCCTTGTTCATATTGAGG - Intronic
1150524050 17:65903066-65903088 GGGTGCCATTGTGCACAGTCTGG - Intronic
1150710812 17:67529439-67529461 CGGTGCTTTTGTTTAAATTGAGG + Intronic
1151255810 17:72875563-72875585 GGGTGCCTTTGTGGGAGATGAGG - Intronic
1157853651 18:51083331-51083353 AGGTGCCTTTATGAGAATTGAGG + Exonic
1158069172 18:53450502-53450524 GGGTGCATTTGTCCAATTGGCGG - Exonic
1161456865 19:4373921-4373943 GGGTGCGTTTCTGCCAACTGTGG + Intronic
1168691295 19:58379206-58379228 GGGTCCCTTTCTGCCAAGTGGGG - Intronic
925070059 2:959723-959745 GGGTGCCGCTGTGCAGATGGAGG + Intronic
925381707 2:3432352-3432374 GTGTGCCTTTATGCACATAGAGG - Intronic
925785066 2:7423929-7423951 GGATCCCTTTGTCCAAATTTAGG - Intergenic
926075529 2:9939816-9939838 AGGTGGCTTTGTGCCAATGGAGG - Intergenic
928048118 2:27959075-27959097 GAGAGCTTTTGTCCAAATTGAGG + Intronic
931461541 2:62454339-62454361 GGGTGCTTTTGTGTGAATCGTGG + Intergenic
932098289 2:68872234-68872256 GGCTGCCTTGGTTGAAATTGTGG - Intergenic
940239657 2:151549332-151549354 GGGTGCATCTGTGCTAAGTGAGG + Intronic
940529481 2:154862364-154862386 GTGTGTCTGTGTGCAAATTCAGG - Intergenic
942396871 2:175559126-175559148 GGGTCCATTTGTGAAAATTTGGG - Intergenic
943984444 2:194602302-194602324 GGGTCCCCTTGGGCAAAATGGGG + Intergenic
1169411225 20:5372061-5372083 GGGTGCCTTGGTTCAAATTCCGG + Intergenic
1177633682 21:23758783-23758805 GTTTGTATTTGTGCAAATTGAGG + Intergenic
1183114796 22:35682706-35682728 GGGTGCCTTTGTTGTAAATGAGG + Intergenic
949333686 3:2950275-2950297 GGCTGCCTTTGTGCAAACTCAGG + Intronic
951062487 3:18225628-18225650 GAGGACCTTTATGCAAATTGAGG + Intronic
951655889 3:25007902-25007924 GGGTGACCTTGGGCAAATTATGG + Intergenic
956026523 3:64988435-64988457 GAGTGCCTTTGTGTAAAAGGTGG + Intergenic
957361933 3:79172126-79172148 GGGAGGCTTAGAGCAAATTGAGG - Intronic
960019590 3:112933339-112933361 GGGTGCTTGTGTGCACATGGTGG - Intronic
963674798 3:148296525-148296547 GGGTGCATTTGTCAATATTGGGG - Intergenic
967894198 3:194383660-194383682 AGGTGCATTTCTGCAAAATGTGG + Intergenic
969851487 4:9960540-9960562 GGGTGCCTTTGATCAGATAGGGG - Intronic
974088229 4:57283580-57283602 CGGTGTCTTTTTGCAAATTGGGG - Intergenic
974514325 4:62888983-62889005 GTGTGAATTTGTGCGAATTGGGG - Intergenic
975560094 4:75701194-75701216 AGATTCCTTTTTGCAAATTGGGG - Intronic
976831809 4:89323603-89323625 GTGTGACTTTGGGCAAATTCTGG + Intergenic
980118042 4:128699970-128699992 GAGTACCCTTGTGCAATTTGTGG - Intergenic
981775184 4:148358951-148358973 GTGTGCGTGTGTGTAAATTGTGG - Intronic
984511752 4:180687008-180687030 AGTTGACTTTGTGCAACTTGAGG - Intergenic
985258622 4:188093779-188093801 GGCTGCCTTTCATCAAATTGAGG - Intronic
987599618 5:20050163-20050185 TTTTGCCTTTGGGCAAATTGAGG + Intronic
988415541 5:30942667-30942689 GGGTTCCTTTTTGTAAAATGGGG - Intergenic
988626713 5:32884374-32884396 GGGTGCATGTGTGCACATGGTGG + Intergenic
990240478 5:53811794-53811816 GGGGGCCTTGCTGCAAAATGTGG - Intergenic
996996930 5:129708078-129708100 GGGTGGTTTTGTGTAAATAGTGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1007633086 6:43283521-43283543 GAGGACCTTTGTGCACATTGCGG + Exonic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011213023 6:84974575-84974597 GGTTGCCTTTGGGAAAATTTGGG - Intergenic
1012727297 6:102830827-102830849 GGTTGCAGTTGTGCAAAATGAGG + Intergenic
1016574082 6:145548188-145548210 GTGCGCCTTTGTGGAAATTGAGG - Intronic
1018330635 6:162724259-162724281 TTGTGCCTTTGTGGAAAGTGTGG - Intronic
1020260963 7:6530708-6530730 GGGTGCTCTTGTGAAAATCGGGG - Intronic
1021469270 7:20982876-20982898 GGGTGCCCCTGAGCAAACTGTGG - Intergenic
1021792419 7:24218744-24218766 GGCTGCCTAGGTTCAAATTGAGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1025035991 7:55592750-55592772 GGGTGCCTCTGTGCAACTGATGG + Intergenic
1032204098 7:129846658-129846680 GACTGCCTGTGTGCTAATTGTGG - Intronic
1036740017 8:11352168-11352190 TGGTGCCTTTGTGCAAATCAAGG + Intergenic
1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG + Intergenic
1038365850 8:26934062-26934084 AGATGCCATTTTGCAAATTGAGG - Intergenic
1039366087 8:36929436-36929458 GGGTGCCTTTGAGCAATTCATGG - Intronic
1040944386 8:52868185-52868207 GGGTGCTTTTGATCAAGTTGAGG + Intergenic
1045558429 8:103237418-103237440 CTGTGCCTTGGGGCAAATTGTGG + Intergenic
1046524121 8:115362142-115362164 GTGTGCCTTTGTGGATACTGTGG + Intergenic
1047773233 8:128047411-128047433 GTGTGCTTTTGTGGAAATGGTGG + Intergenic
1049336365 8:142088832-142088854 GGCTGCCTGTGTGCAGACTGTGG - Intergenic
1051506875 9:17837319-17837341 GGGTGCTTTTGTGTGAATTGTGG + Intergenic
1052153193 9:25146220-25146242 AGATGCCTTTTTTCAAATTGAGG - Intergenic
1053219142 9:36297188-36297210 TGGTCCATTTGTGAAAATTGTGG + Intronic
1054784456 9:69197723-69197745 GGTTGCCTATCTGCAAAATGAGG - Intronic
1057180531 9:93027274-93027296 CAGTGCCTCTGTGCAAATTCTGG - Intronic
1057928681 9:99174552-99174574 GGGTGACTTTATGGGAATTGGGG + Intergenic
1058822320 9:108744152-108744174 GGCTGCCTTTGAGCAATGTGTGG + Intergenic
1058841949 9:108918420-108918442 TGGTGCTTTTGTGGAAATTAGGG - Intronic
1059261591 9:112982282-112982304 GGGTGCTCTTGTCCAAGTTGTGG - Intergenic
1186154747 X:6713156-6713178 ACTTGCCATTGTGCAAATTGTGG - Intergenic
1190832118 X:54068263-54068285 GGATCCCTTTCTGCAAATGGGGG - Intergenic
1194031781 X:88825910-88825932 GGGTGCCTTTGGACCACTTGGGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1197364968 X:125552872-125552894 GGGTTTCTTTCTACAAATTGTGG - Intergenic