ID: 1096614989

View in Genome Browser
Species Human (GRCh38)
Location 12:52827141-52827163
Sequence TGGAAGGGCTAGACTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096614989_1096614994 12 Left 1096614989 12:52827141-52827163 CCTCTAGAAGTCTAGCCCTTCCA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096614989 Original CRISPR TGGAAGGGCTAGACTTCTAG AGG (reversed) Intronic
900588293 1:3444570-3444592 GGGCACGGCAAGACTTCTAGGGG + Intergenic
905589942 1:39154536-39154558 TGGAAGGTGTTGATTTCTAGGGG + Intronic
907661878 1:56400779-56400801 TGGAAGGGGTAGAATTTTATAGG + Intergenic
907911352 1:58829436-58829458 TGGAAGGGCTAGAGGGCTAGAGG + Intergenic
918180184 1:182080699-182080721 TGGAAGGGCCAGACTTCCCCTGG + Intergenic
922749175 1:228062754-228062776 TGGGAAGGCCAGGCTTCTAGTGG - Intergenic
1067829395 10:49601589-49601611 TGGAAGAGCTACATTTCTAAAGG + Intergenic
1068657787 10:59592776-59592798 TGGAAATGAGAGACTTCTAGCGG + Intergenic
1072198705 10:93139602-93139624 TCAAAGGGGTAGACTTCCAGAGG - Intergenic
1072895402 10:99362220-99362242 TTAAAGGGCTCCACTTCTAGAGG - Exonic
1083222980 11:61265387-61265409 TCGAGGGGCTTGAATTCTAGTGG - Intronic
1083806322 11:65076519-65076541 TGGAAAGGCTAGCCTTGAAGAGG + Intronic
1090572362 11:128061215-128061237 AGGAATGTCTAGACTTCCAGTGG - Intergenic
1091433245 12:453833-453855 TGGAAGGGCTGGCGTTCTCGCGG + Intergenic
1091984249 12:4895150-4895172 TTAAAGTGCTAGGCTTCTAGAGG - Intergenic
1096614989 12:52827141-52827163 TGGAAGGGCTAGACTTCTAGAGG - Intronic
1098275145 12:68805237-68805259 TGGAAGGGCGGGCCTGCTAGCGG + Intergenic
1102645523 12:114401142-114401164 TAGAAATGCTAGACTTCTGGGGG - Intronic
1121679602 14:95782168-95782190 GAGAAAGGCTAGACTTCAAGAGG - Intergenic
1124882003 15:33651514-33651536 GGAAAGTGATAGACTTCTAGAGG + Intronic
1125505303 15:40264653-40264675 GGGAAGCCCTAGGCTTCTAGGGG + Intronic
1130943423 15:88531125-88531147 TGGAGGGAATAGTCTTCTAGAGG + Exonic
1134476251 16:14576250-14576272 AGGAAGGCCTAGATTTCCAGCGG + Intronic
1135676456 16:24418913-24418935 TGGGAGTGCTAGACTGCTAAGGG + Intergenic
1138289283 16:55833058-55833080 TGGAAGGGCGACAGTTCTCGGGG + Exonic
1142140086 16:88468912-88468934 TGGAAGGGCCCGCCTTTTAGGGG + Intronic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1146671805 17:34742892-34742914 TGGAAGGAATAGAGTTGTAGAGG - Intergenic
1152244004 17:79175888-79175910 TGGAAGGGCAAGACGGCTGGTGG + Intronic
941297394 2:163757100-163757122 AGGGAGTGTTAGACTTCTAGAGG + Intergenic
944437299 2:199704067-199704089 AGGAAGAGCTATATTTCTAGAGG - Intergenic
945936891 2:215911727-215911749 TGGAAGGGCTAGAATCGCAGTGG - Intergenic
946757081 2:222958574-222958596 TGTAATGGCTGGACCTCTAGAGG + Intergenic
947106371 2:226672131-226672153 GAGAAGGGCCAGAGTTCTAGAGG + Intergenic
1169914282 20:10671893-10671915 TGGAAGGGGTGGTCTTCTGGAGG - Intronic
1171400507 20:24870396-24870418 TGGATGGGCTTAACTTCTTGGGG + Intergenic
1176967223 21:15224851-15224873 TGGACGGGCTAGACTGATTGAGG - Intergenic
1179878137 21:44281811-44281833 TGGAAGGGCCAGGCTCCCAGAGG - Intergenic
1180109337 21:45640771-45640793 TGGAAGGGCTGGGCTTCTCCAGG + Intergenic
1181682851 22:24507857-24507879 TGGGAGGGCTAGATTTTTTGCGG + Intronic
1184196497 22:42932875-42932897 TGGAAAGTGTGGACTTCTAGTGG - Intronic
949238697 3:1843036-1843058 TGGCAGAGCCAGAGTTCTAGAGG - Intergenic
950788503 3:15454529-15454551 GGGCAGGGCCAGCCTTCTAGGGG + Intronic
951019168 3:17763792-17763814 TGAATGGGCTAGCCTGCTAGTGG - Intronic
962333896 3:134507980-134508002 TGGAAGAGTTAGAGTTATAGGGG + Intronic
962531617 3:136286504-136286526 TGGCAGGTCTAGTCTTCCAGTGG + Intronic
963886514 3:150588757-150588779 TGTAAGTGCTAGACTTTTATAGG - Intronic
966496550 3:180587797-180587819 TGGTAGGGCTAGCCTTAGAGAGG + Intergenic
975876885 4:78851305-78851327 CAGAAGGGCTAGTCTTCGAGAGG + Intronic
978287075 4:107092079-107092101 TGGAAGGAATAGCCTTCTAGTGG + Intronic
978673089 4:111274911-111274933 TGGAAGGCCTAGATTGCTGGAGG + Intergenic
981574010 4:146184605-146184627 AGGAAGTAATAGACTTCTAGGGG + Intronic
983689699 4:170453251-170453273 TGGAAGGTGGAGACTTCTGGTGG - Intergenic
996093879 5:119377963-119377985 TGGAAAGGGTAGTCTTCTAAAGG + Intronic
999373107 5:151068187-151068209 TGGAGGGCCTGGACTTCTGGAGG + Intronic
1002098954 5:176847981-176848003 GGGAAGGGCTGGGCTTCTTGAGG + Intronic
1007663296 6:43499527-43499549 AGGAAGGGCTGGACTTCCTGGGG - Intronic
1008884987 6:56423065-56423087 TGGATATGATAGACTTCTAGAGG - Intergenic
1010766157 6:79778752-79778774 TGGAAGGGCCAGACTTTGAAAGG + Intergenic
1017920226 6:158865321-158865343 TGGAAGGGCTTGCAGTCTAGTGG - Intergenic
1018554784 6:165037884-165037906 TGGTAGGATTAGACTTCTAGGGG - Intergenic
1019512605 7:1425604-1425626 AGGAACAGTTAGACTTCTAGAGG - Intergenic
1019934587 7:4246012-4246034 TGGAATGTCTAGACTGCTCGAGG - Intronic
1022482544 7:30753269-30753291 AGGAAGGGCTGGACTTCCAGGGG + Intronic
1024872850 7:53985658-53985680 TGGAAGAGCAAGACTTCAAGAGG - Intergenic
1027050346 7:75017862-75017884 TGGAAGGGCAAGGCTGCAAGGGG - Intronic
1029382688 7:100223789-100223811 TGGAAGGGCAAGGCTGCAAGGGG + Intronic
1030720633 7:112866539-112866561 AGGAAGGGCGTGAGTTCTAGTGG + Intronic
1038127111 8:24686743-24686765 CGGAAGGTCTTGTCTTCTAGTGG - Intergenic
1047786499 8:128158595-128158617 TGGAAGGGCCAGACTCCAAGGGG - Intergenic
1048806355 8:138245119-138245141 AGTAAGGGCTAGACTTCTTCAGG - Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1055029298 9:71757115-71757137 TGGAAGGGCTAGATTATTTGGGG - Intronic
1056272420 9:84959410-84959432 TGGAAGGCTTGGACTTCTAGTGG - Intronic
1057400559 9:94719698-94719720 TGGAAGGGGAAGGCTCCTAGGGG - Intergenic
1058069915 9:100591438-100591460 TGGAATGGGCAGACCTCTAGTGG - Intergenic
1198933467 X:141883316-141883338 AGCAAGGGCTAGATTTTTAGTGG + Intronic
1198962892 X:142201674-142201696 AGCAAGGGCTAGATTTTTAGTGG - Intergenic
1201967078 Y:19750004-19750026 TGGAAGGGCCAGACTTTTTCTGG - Intergenic
1202018155 Y:20434273-20434295 TAGAAGGGAGAGACTTGTAGCGG + Intergenic