ID: 1096614994

View in Genome Browser
Species Human (GRCh38)
Location 12:52827176-52827198
Sequence TCAGAAGTCACCTCCCTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096614991_1096614994 -4 Left 1096614991 12:52827157-52827179 CCTTCCATCAAGATCCAACTCAG 0: 1
1: 0
2: 3
3: 36
4: 222
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1096614986_1096614994 25 Left 1096614986 12:52827128-52827150 CCTTCCTGCTCCTCCTCTAGAAG 0: 1
1: 0
2: 0
3: 48
4: 388
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1096614992_1096614994 -8 Left 1096614992 12:52827161-52827183 CCATCAAGATCCAACTCAGAAGT 0: 1
1: 0
2: 8
3: 60
4: 335
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1096614990_1096614994 -3 Left 1096614990 12:52827156-52827178 CCCTTCCATCAAGATCCAACTCA 0: 1
1: 0
2: 1
3: 33
4: 216
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1096614987_1096614994 21 Left 1096614987 12:52827132-52827154 CCTGCTCCTCCTCTAGAAGTCTA 0: 1
1: 0
2: 0
3: 18
4: 137
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1096614989_1096614994 12 Left 1096614989 12:52827141-52827163 CCTCTAGAAGTCTAGCCCTTCCA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1096614988_1096614994 15 Left 1096614988 12:52827138-52827160 CCTCCTCTAGAAGTCTAGCCCTT 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096614994 Original CRISPR TCAGAAGTCACCTCCCTCGA AGG Intronic
900191699 1:1354863-1354885 TGAGAAGTCACCGCGCTCAAAGG + Exonic
901133915 1:6980490-6980512 ACAGAAGTCACGTCCCTCTAGGG - Intronic
902048293 1:13542224-13542246 TCAAATGTCACCTCCTCCGAAGG - Intergenic
902632294 1:17712247-17712269 TCAGGAGGCACCTCCCTGGAAGG - Intergenic
903622482 1:24707870-24707892 TCAGCTGTCAACTCCCTTGAGGG - Intergenic
904591182 1:31616421-31616443 CCAGGAGTCACCTCCCAGGAGGG + Intergenic
915298283 1:154937049-154937071 TCAGACGTCACCCCCCTCGGAGG - Intergenic
920645890 1:207804228-207804250 TCAGAAAGCACCTTCCTCCATGG + Intergenic
920998618 1:211018967-211018989 TCAGAAATCACCTCCCCTGCTGG + Exonic
922472684 1:225886691-225886713 ACACAAGTCAAGTCCCTCGATGG + Exonic
1062958318 10:1554543-1554565 CCTGAAGTCACCTCCCCCGGGGG - Intronic
1065794967 10:29298311-29298333 GCACAAGTCACATCCCTTGAAGG - Intronic
1069593823 10:69657623-69657645 TCAGAAGTGACCTACCTCAGAGG - Intergenic
1070997575 10:80799607-80799629 TCAGAATTCTCTTCCCTCTATGG + Intergenic
1072044622 10:91642562-91642584 TCAGATGTCACCTGCCCAGATGG + Intergenic
1072049342 10:91688073-91688095 TCAGGAGGCACCTCCCTTGAGGG - Intergenic
1075464187 10:122639179-122639201 TCAGAATTTACCTCCATCGTAGG + Intronic
1078010331 11:7568602-7568624 ACAGAGGCCACCTCCCTCTATGG - Intronic
1079107012 11:17578254-17578276 TCGGAAGTCTCCTCCCTCCCTGG - Intronic
1084586548 11:70065848-70065870 TCAGATGTCACTTCCCCGGAAGG + Intergenic
1089247500 11:117132966-117132988 ACACAAGCCACCTCCCTAGAAGG + Intergenic
1093913993 12:24779761-24779783 TAAGAAGTCACTTACCTAGACGG + Intergenic
1094470107 12:30795533-30795555 CCAAGGGTCACCTCCCTCGAGGG - Intergenic
1094694873 12:32808673-32808695 TCAGAAGTCAGCAGCCTCAAAGG - Intronic
1096614994 12:52827176-52827198 TCAGAAGTCACCTCCCTCGAAGG + Intronic
1100261702 12:92938318-92938340 TCAGAAGCCACCTCAGTGGATGG + Intergenic
1102002483 12:109566070-109566092 CCAGAATTCAGCTCCCTCCAGGG - Intronic
1107254020 13:38401674-38401696 TAAGAAGTCACCTCCCAACATGG + Intergenic
1108431858 13:50361268-50361290 TGAGAAGCCACCTCCATAGAAGG - Intronic
1114383215 14:22230939-22230961 TCAGATCTGACCTCCCTAGATGG + Intergenic
1119384478 14:74248872-74248894 TCAGGAGGCACCTCCCTGGAAGG - Intronic
1119892794 14:78195573-78195595 TCAGATGTCATCTCCCCAGATGG - Intergenic
1121413193 14:93762028-93762050 ACAGAAACAACCTCCCTCGATGG + Intronic
1122191869 14:100051411-100051433 ACAGAAGTCACCTTCATCCATGG - Intronic
1124099311 15:26678709-26678731 TCAGAACTCACCTTCCTGGGTGG - Intronic
1128082223 15:64863460-64863482 TCAGAGGGCCCCTCCCTCCAAGG - Intronic
1128242368 15:66109733-66109755 TCAAAACTCACCTCCCTGAAGGG + Intronic
1129388911 15:75210831-75210853 TCAGAAGTCACCGGCCCCCAAGG + Exonic
1132084221 15:98893564-98893586 TCAGACGTCACCTTCCTCCTTGG + Intronic
1136470086 16:30474051-30474073 CCAGAAGTCAACGCCCTGGAGGG + Intronic
1137835677 16:51590071-51590093 TCAGAATTCTCCTCCATCCAGGG - Intergenic
1139407714 16:66732248-66732270 ACAGAAGGCACCTTCCTTGAAGG + Intronic
1141497784 16:84421815-84421837 TCAGAACTCACCACCCCCAATGG - Intronic
1144785082 17:17827037-17827059 TCAGATGTCACCTCCTAAGATGG - Intronic
1146141915 17:30375601-30375623 TGAAGAGTCACCTCCCTCGGTGG - Intergenic
1146404704 17:32527219-32527241 TCTGAAGTCCCCTCTCTGGATGG - Intronic
1151808647 17:76422682-76422704 TCAGATGTCACCTCCTCAGAAGG + Intronic
1155187724 18:23402034-23402056 TCCGAAGTCATCTCCCTCAGGGG + Intronic
1166105604 19:40596783-40596805 TCAGAATTTAGCTCCCTCGCTGG - Intronic
1166672552 19:44719594-44719616 TCAGATGTCACCTCCTCAGAGGG + Intergenic
1167247978 19:48385294-48385316 TCATTAGTCACCTCCCGAGAGGG + Intronic
1167603023 19:50465453-50465475 TCAGAAGTCACCATCCGGGAGGG - Intronic
934737120 2:96695263-96695285 CCAGAGGTCACCTCCCTCATGGG + Intergenic
935815287 2:106841720-106841742 TCAGAATTCCCCTTCCTCGCTGG - Intronic
937261337 2:120588351-120588373 TCAGGTGTCACCTCCTTCGAGGG - Intergenic
939703825 2:145427416-145427438 TCAGAAGTAATTTCCCTGGAAGG + Intergenic
943270597 2:185797643-185797665 TCAGTAGTCATCTACCTCCAAGG - Intronic
1172275589 20:33677215-33677237 TCAGAAGTGACCTCCTGGGATGG + Exonic
1173405712 20:42762632-42762654 ACAAAAGTGACCTCCCTCCAAGG - Intronic
1176132945 20:63503975-63503997 TCAGAAGTCACCTTTACCGAGGG - Intergenic
1177300992 21:19245373-19245395 CCAGACATCACCTGCCTCGAGGG + Intergenic
1181456596 22:23063519-23063541 GCAGACATCACCTCCCTGGAGGG + Intronic
1182248801 22:28983150-28983172 TCAGAAGTCAATGCCCTTGACGG + Intronic
1183394501 22:37563487-37563509 TCAGAAGTTCCCCCCCACGAGGG + Intronic
950336275 3:12196405-12196427 TCAGAAGTCACCTACGATGAGGG - Intergenic
952333880 3:32388508-32388530 TCAGAGGTCACCTACCTGGTTGG + Intergenic
966783378 3:183603834-183603856 TGAGATTTCAGCTCCCTCGACGG - Intergenic
972929853 4:44058763-44058785 TCACAAGACACCTCCTTCCAAGG + Intergenic
973949608 4:55998355-55998377 TCAGAAGTAACGTTCCTGGAAGG - Intronic
986372956 5:7098958-7098980 GCAGGAGTCACACCCCTCGAGGG - Intergenic
987395103 5:17415703-17415725 TCTCACGTCACCTCCCTGGAGGG - Intergenic
988824919 5:34926553-34926575 TCAGCAGCCACCTACCTCCATGG - Intergenic
997566619 5:134892516-134892538 TCAGAGGTCACCACACTGGATGG + Intronic
997732321 5:136190862-136190884 TCAGGAGTCACCTGGCTCAATGG - Intergenic
998937588 5:147247175-147247197 GCAGAAGTCAGCTCCCATGAAGG - Intronic
999764283 5:154726828-154726850 GCAGAAGTCACCTCCGTACAGGG + Intronic
1001865781 5:175104190-175104212 TCAGAAAACACCTCCTTCTACGG - Intergenic
1003643879 6:7898726-7898748 TCAGAAGGCACCACCCACAAAGG + Intronic
1004701899 6:18087377-18087399 TCCCAAGACACCTGCCTCGAGGG + Intergenic
1005433457 6:25782763-25782785 GCACAAGTCAGCTCCCTCGCTGG - Intergenic
1015418504 6:132978672-132978694 TCAGAAGTCACCTTTTTAGAAGG + Intergenic
1024376265 7:48642131-48642153 TCAGATGTCACTTCCCTCTGAGG - Intronic
1028603064 7:92623770-92623792 AGAGAAGTCTCCTCCCTCAAGGG - Intronic
1031873170 7:127109559-127109581 TCAAAAGTCACCTCCATCTGGGG + Intronic
1032203088 7:129837206-129837228 TCAGAAATCATCTCCCTGGAGGG + Intronic
1034119046 7:148610635-148610657 TCAGAAGTGATCTCCCTCCTCGG - Intronic
1034864313 7:154627839-154627861 GCAGAAGTCACATCCCTCCATGG - Intronic
1035363184 7:158327819-158327841 TCTGAAGTCCCCTCCCTGCAGGG + Intronic
1035758268 8:2050272-2050294 TCAAATGTCACCTGCCTCGTGGG + Intronic
1047303066 8:123631371-123631393 TCAAATGTCACCTCCCTCCAAGG - Intergenic
1048228529 8:132614212-132614234 TCAGATGTCACCTCATTAGAGGG - Intronic
1048525355 8:135197449-135197471 TCAGAAGTCCCTGCCCTCCAGGG - Intergenic
1052688732 9:31787591-31787613 GGAGAAGTTACCTCCCTCCAAGG + Intergenic
1053443358 9:38133249-38133271 TCAAAGGTCACCTCCCCCAAAGG + Intergenic
1186529601 X:10282048-10282070 GCAGAAAGCACCTCCCTCCATGG + Intergenic
1189259694 X:39669574-39669596 TCACCAGCCACCTTCCTCGATGG - Intergenic
1192303201 X:69928204-69928226 TCAGATGTCATCTCCCTAGCTGG + Intronic
1200211433 X:154348416-154348438 GCACAGGTCACCTCCCTCCAGGG - Intergenic
1200482426 Y:3722205-3722227 GGAGAAGTCACCTCCCTGAAGGG + Intergenic
1202387598 Y:24340453-24340475 TCAGAAGTCAGCTCCCCTCATGG + Intergenic
1202483188 Y:25329675-25329697 TCAGAAGTCAGCTCCCCTCATGG - Intergenic